Избранная запись

instruk4Мы постарались собрать наиболее полный каталог инструкций, руководств и справочников на русском языке. Документы распределены по категориям. Все материалы в свободном доступе и доступны для скачивания.

Наполнение каталога еще продолжается и все обновления будут анонсироваться.

Терновых к с бизнес планирование на предприятиях апк практикум

Эта страница «Терновых к с бизнес планирование на предприятиях апк практикум» создана для пользователей, которые хотят найти советы и инструкции, которые относятся к теме этого проекта «Инструкции и советы для всех».

 

Терновых к с бизнес планирование на предприятиях апк практикум

 

терновых к. с. (ред.) Планирование на предприятии

терновых к. с. (ред.) Планирование на предприятии апк djvu

авт: к. с. терновых, а. с. алексеенко, а. с. анненко и др.; Под ред. К. с. терновых. — М. колосс, 2007. — 333 с. ил. — (Учебники и учебные пособия для студентов высших учебных заведений). текст распознан.

isbn 978-5-9532-0520-7.

в учебном пособии рассмотрены конкретные проблемы планирования на предприятии апк. Раскрыты теоретические, методологические и организационные основы планирования, его формы, функции и методы, система плановых показателей и расчетов. Представлены виды планов, Терновых к с бизнес планирование на предприятиях апк практикум, принципы стратегического и бизнес-планирования. Анализируются годовой план производственно-финансовой деятельности сельскохозяйственного предприятия, производственные программы развития отраслей растениеводства и животноводства, а также вспомогательных отраслей, особенности планирования численности работников и фонда заработной платы, механизма ценообразования, финансов, Терновых к с бизнес планирование на предприятиях апк практикум, бюджетного планирования. Для студентов вузов по агроэкономическим специальностям.

предисловие.

раздел i. методологические основы планирования на предприятии апк.

глава І. предмет и задачи науки «планирование на предприятии апк».

предмет, объект и задачи науки.

экономическая сущность и содержание планирования.

глава ii. Основные формы, принципы и функции планирования на предприятии.

текущие планы (план производственно-финансовой деятельности сельскохозяйственного предприятия).

оперативные планы.

глава vi. Стратегическое планирование развития предприятия апк.

сущность и содержание стратегического планирования

сущность и содержание стратегического планирования.

этапы стратегического планирования на предприятии.

структура и содержание стратегических планов предприятия.

глава vii. Бизнес-планирование на предприятии.

бизнес-план и его роль в предпринимательстве.

цели, задачи, функции и принципы бизнес-планирования.

место бизнес-плана в системе планирования и отличие его от других плановых документов.

структура и последовательность разработки бизнес-плана.

организация процесса бизнес-планирования.

особенности и технология бизнес-планирования на сельскохозяйственных предприятиях.

глава viii. Организация планирования на сельскохозяйственном предприятии.

формирование заказа на производство и реализацию продукции.

роль отраслевых специалистов и экономической группы в организации внутрипроизводственного планирования.

организация работы в предплановый период.

организация работы в плановый период.

раздел iii. Практика планирования на сельскохозяйственном предприятии.

глава ix. Годовой план производственно-финансовой деятельности сельскохозяйственного предприятия.

задачи годового планирования.

порядок разработки годового плана.

методика разработки годового плана.

глава x. планирование производственной программы развития растениеводства. Планирование использования земельных угодий.

обоснование уровня урожайности сельскохозяйственных культур.

определение посевных площадей и валовых сборов продукции.

определение потребности в семенах.

расчет потребности в удобрениях и средствах защиты растений.

баланс продукции растениеводства.

определение затрат и исчисление себестоимости продукции растениеводства.

глава xi. Планирование производственной

глава xi. Планирование производственной программы по животноводству.

содержание производственной программы по животноводству.

планирование продуктивности животных.

планирование случки и поступления приплода.

значение, содержание и порядок разработки плана оборота стада.

планирование развития кормовой базы.

планирование производства и распределения продукции животноводства.

планирование затрат на производство и калькулирование себестоимости продукции

животноводства.

глава xii. Планирование производства, себестоимости и реализации продукции вспомогательного и обслуживающего производств.

система инженерно-технического обслуживания на предприятии апк.

определение потребности в тракторах и самоходных сельскохозяйственных машинах.

планирование ремонта и технического обслуживания тракторов, Терновых к с бизнес планирование на предприятиях апк практикум, самоходных сельскохозяйственных машин.

планирование транспортных работ.

определение потребности в топливе и смазочных материалах.

планирование энергоснабжения производства.

планирование себестоимости единицы продукции и услуг обслуживающих производств.

глава xiii. Планирование численности и фонда заработной платы работников.

анализ существующих структуры и фонда заработной платы.

планирование численности работников.

планирование фонда заработной платы работников.

глава xiv. Планирование цен на предприятии.

механизм ценообразования на предприятии.

особенности планирования цен и ценообразования на сельскохозяйственном предприятии.

глава xv. Финансовое планирование на предприятии

глава xv. Финансовое планирование на предприятии.

содержание, цель и задачи финансового планирования.

методика составления плановых финансовых расчетов на пред приятии.

совершенствование финансового планирования на основе операционного бюджетирования.

бизнес-планирование на предприятии апк. Практикум

дана информационно-нормативная база для выполнения курсовых проектов по бизнес-планированию. Для студентов вузов по агроэкономическим специальностям. Приведены таблицы с данными, которые можно использовать на практике при разработке бизнес-планов, Терновых к с бизнес планирование на предприятиях апк практикум, в том числе для малых перерабатывающих предприятий. Рассмотрены методика составления бизнес-плана, анализ и оценка финансового состояния предприятий апк.

стаканчик для приготовления мороженого — это удивительно быстрый и легкий способ приготовить мороженое дома. С его помощью вы всего за

997 руб

цвет — серый. Ширина — 255 мм. Поставляется в компактном разобранном виде. Легко собирается и разбирается. Упакована в термоусадочную

организация и планирование производства на предприятиях апк -организация предпринимательской деятельности

1. общие положения

1.1. на обучение по программам магистратуры принимаются заявления от лиц, имеющих документ государственных образца о высшем профессиональном образовании различных ступеней.

1.2. поступающий в магистратуру должен:

-знать основные категории экономической науки и социологии, понимать суть социально-экономических явлений, владеть методами анализа и социальных процессов;

-понимать законы функционирования организаций, уметь анализировать и осуществлять основные функции менеджмента;

-владеть практическими навыками менеджера (осуществление коммуникаций, принятие управленческих решений, управление конфликтами и стрессами и др.)

2. программа вступительных испытаний

2. программа вступительных испытаний

вступительные испытания в магистратуру по направлению 080200.62м «менеджмент» профиль «производственный менеджмент в организациях апк» проводится в виде комплексного экзамена по дисциплинам направления (в устной форме). продолжительность экзамена 2 часа (120 минут).

дисциплины, включенные в комплексный экзамен:

-организация и планирование производства на предприятиях апк

-организация предпринимательской деятельности

— экономика апк

— управление апк

организация и планирование производства на предприятиях апк

предмет, задачи и метод науки «организация и планирование с.-х. производства». Закономерности и принципы организации и планирования с.-х. производства. Внутрихозяйственное, бизнес-планирование, стратегическое, текущее и оперативное, финансовое планирование на предприятии.

сущность и классификация организационных форм производства и предприятий. Организационно-экономические основы с.-х. кооперативов, Терновых к с бизнес планирование на предприятиях апк практикум, товариществ, Терновых к с бизнес планирование на предприятиях апк практикум, обществ, Терновых к с бизнес планирование на предприятиях апк практикум, унитарных предприятий, к (ф)х, объединений предприятий.

организация и планирование использования ресурсного потенциала с.-х. предприятий. Основы рациональной организации и планирования производства на с.-х. предприятиях: система ведения хозяйства; организация материального стимулирования. Организация и планирование отраслей растениеводства, животноводства, подсобных промышленных производств. Производственно-экономические связи с.-х. предприятий с организациями других сфер апк: организация и планирование материально-технического обеспечения с.-х. предприятий; организация и планирование производственного обслуживания с.-х. предприятий; организация и планирование хранения, переработки и реализации продукции на с.-х. предприятиях.

организация предпринимательской деятельности

организация предпринимательской деятельности

принципы организации и развития профессионального предпринимательства. Профессиональные компетенции предпринимательских фирм. Предпринимательская миссия и спрос на нее. Целеполагание и целедостижение в бизнесе. Предпринимательское администрирование межфирменных коммуникаций. Система администрирования предпринимательских коммуникаций. Предпринимательская коммуникабельность. Межфирменные предпринимательские коммуникации. Предпринимательские коммуникации с клиентами, с поставщиками, с конкурентами и партнерами по совместному бизнесу. Конкуренция субъектов предпринимательства. Предпринимательский имидж. Gr – pr – коммуникации в предпринимательстве. Межфирменная инфраструктура предпринимательского бизнеса. Внутрифирменные коммуникации. Предпринимательский менеджмент. Учреждение и регистрация новой предпринимательской фирмы. Вхождение в бизнес на основе реорганизации действующих фирм. Разгосударствление государственных предприятий. Раскрутка бизнеса. Стадии освоения бизнеса. Формирование потенциала конкурентоспособной фирмы. Управление изменениями в бизнесе. Реорганизация предпринимательской фирмы. Слияние и присоединение предпринимательских фирм. Создание предпринимательских объединений. Разделение и выделение предпринимательских фирм. Экономические методы принятия предпринимательских решений. Оценка эффективности предпринимательской деятельности. Информационная основа анализа деятельности предпринимательской фирмы.

экономика апк

экономика апк

понятие, состав и структура апк и ее экономическая эффективность. Размещение, специализация и концентрация производства в сельском хозяйстве.

понятие рынка и его структура. Предпосылки рыночной экономики и ее значение. Конечный продукт апк: методика определения его экономической эффективности. Рыночные каналы реализации продукции апк. Рынок факторов производства. Цены и ценообразование на продукцию предприятия.

предприятие апк как экономическая система. Предприятие в условиях рыночной экономики. Производственный процесс на предприятии и формы его организации. Формы организации производства на предприятии.

земельные ресурсы предприятия. Основные средства предприятия. Оборотные средства предприятия. Трудовые ресурсы предприятия и производительность труда.

научно-технический прогресс и потенциал предприятия. Технологическая подготовка производства.

издержки предприятия, себестоимость, ее состав и структура. Продукция. Системный подход к управлению качеством. Принятие хозяйственных решений. Прекращение деятельности предприятия. Кооперация и агропромышленная интеграция в апк.

сравнительная характеристика методов финансирования проектов и обслуживание долга. Методы экономического обоснования инвестиций. Экономическая эффективность инвестиционных проектов.

оценка стоимости объектов недвижимости. Кредитование недвижимости. Государственное регулирование рынка недвижимости. Рынок недвижимости в системе рынков.

экономика производства продукции растениеводства. Экономика производства продукции животноводства.

управление апк

роль управления производством в условиях развития рыночных отношений. Формирование основных управленческих концепций и их развитие. Современные тенденции в развитии теории и практике управления за рубежом. Развитие отечественной управленческой мысли.

теории управления в россии. Законы, закономерности

теории управления в россии. Законы, закономерности и принципы управления производством. Системный подход к управлению производством. Компоненты системы производства. Характеристика производственного процесса. Пути совершенствования структуры управления. Органы управления на предприятиях апк. Система подготовки и переподготовки кадров апк. Государственное управление апк. Становление советской системы управления сельским хозяйством. Государственные органы управления апк. Аграрная политика. Методы государственного регулирования. Взаимодействие органов государственной власти и органов местного самоуправления. Финансовые основы организации муниципального управления. Экономические основы организации муниципального управления. Ресурсный потенциал региона и муниципальных образований

маркетинг и общество. Особенности маркетинговых решений и стили поведения на рынках апк. Организация зарубежных торговых сетей и систем продвижения товаров. Организация и эффективность маркетинга апк. Инновационные программы и проекты. Рынок новаций как источник инновационных предложений. Инвестиции в инновации апк. Риск инновационных проектов и методы его снижения правовое обеспечение инновационной деятельности сельском хозяйстве. Стратегия управления человеческими ресурсами и стратегия бизнеса. Практические шаги по разработке стратегии управления персоналом. Информация и коммуникационный процесс в системе управления предприятием. Стратегическое управление. Процесс выработки стратегии. Управление стратегическими возможностями. Стратегические зоны хозяйствования. Стратегические хозяйственные центры. Рыночная и функциональная стратегия предприятия. Осуществление выработки общей концепции бизнеса. Определение и детализация целей бизнеса. Определение и обоснование мер для обеспечения концепции бизнеса, для достижения общих и частных целей. Регламентация деятельности стратегических зон хозяйствования. Разработка документального обеспечения выполнения стратегических зон хозяйствования. Проработка мероприятий по мотивации персонала. Констатация возникновения проблемной ситуации и ее описание. Способы определения причин возникновения проблемных ситуаций в организации. Понятие и виды управленческих решений. Управление природопользованием и охранной окружающей среды. Природные ресурсы как объект управления. Механизм государственного управления природопользованием и охраной окружающей среды. Управления природопользованием на предприятии апк. Управление рисками предприятий. Пути повышения эффективности управления. Показатели эффективности управления.

3. информационно-методическое обеспечение

3. информационно-методическое обеспечение

организация и планирование производства на предприятиях апк

основная литература:

конституция российской федерации. Серия «закон и общество». Ростов – на — дону, «феникс», 2004. – 48 с.

федеральный закон от 25 июля 2011 года n 260-фз «о развитии сельского хозяйства».

федеральный закон от 30 сентября 2003 г. 131-фз «об общих принципах организации местного самоуправления в российской федерации».

федеральный закон от 26 октября 2002 г. 127-фз «о несостоятельности (банкротстве)» (с изм. И доп. От 22 августа, 29, 31 декабря 2004 г. 24 октября 2005 г. 18 июля, 18 декабря 2006 г. 5 февраля, 26 апреля, 19 июля 2007 г.).

федеральный закон от 11 июня 2003 г. 74-фз «о крестьянском (фермерском) хозяйстве» (с изм. И доп. От 4 декабря 2006 г.).

федеральный закон от 10 июля 2003 г. 112-фз «о личном подсобном хозяйстве».

федеральный закон от 29 декабря 2006 г. 264-фз «о развитии сельского хозяйства».

федеральный закон от 9 июля 2002 г. 83-фз «о финансовом оздоровлении сельскохозяйственных товаропроизводителей» (с изм. И доп. От 29 июня 2004 г.).

постановление правительства рф от 29 апреля 1994 г. 406 «вопросы кредитования крестьянских (фермерских) хозяйств.

постановление правительства рф от 7 декабря 2000 г. 927 «о государственной поддержке развития фермерства и других субъектов малого предпринимательства в сельском хозяйстве» (с изм. И доп. От 1 февраля 2005 г.).

распоряжение администрации тюменской области от 21 сентября 1992 г. 647-р «о мерах по развитию крестьянских (фермерских) хозяйств»

областная целевая программа «основные направления

областная целевая программа «основные направления развития агропромышленного комплекса» на период 2006-2012 гг. Тюменская область, 2005

дополнительная литература:

бизнес-планирование /под ред. В. м. попова, с. и. ляпунова. – М. финансы и статистика, 2001

прогнозирование и планирование в условиях рынка: учеб. Пособие / под ред. Т. г. морозовой. – М. юнити — дана, 2001

владимирова л. п. прогнозирование и планирование в условиях рынка: учеб. Пособие. – М. дашков и ко, 2000

прокопчук л. о. козырев а. а. стратегическое планирование: конспект лекций. – Спб. Изд-во михайлова в. а. 2000

алемайкин и. д. справочник по планированию в животноводстве и ветеринарии. — Спб. Лань, 2005

планирование на предприятии. / Симулин е. н. васильцова в. м./ — м. кнорус, 2008

мильнер б. з. теория организации: учебник. – М. инфра – м, 2003

организация производства на предприятиях апк / под ред. Ф. к. шакирова. – М. колос с, 2003

леонова л. а. организация сельскохозяйственного производства. Альбом наглядных пособий. — Спб. Лань, 2007

организация сельскохозяйственного производства. Методические указания по выполнению курсового проекта для студентов специальности 080502 «экономика и управление на предприятии апк»

организация и управление производством на сельскохозяйственных предприятиях./ Под ред. Водянникова в. т./ — м. кнорус, 2005 г.

организация и управление производством./ Коротнев в. д. винничек, л. б. кочетова г. н./ — м. колос,2005.

организация с/х производства и менеджмента./Шакиров ф. к. королев ю. б. пастухов а. к./ -м. колос,2008 г.

практикум по организации и управлению производством

практикум по организации и управлению производством на с/х предприятиях./Водянникова в. т. люсюк а. и., кушнарев л. и. и др. – М. колос,2007 г.

периодические издания:

«экономика сельскохозяйственных и перерабатывающих предприятий»

«экономика сельского хозяйства»

базы данных, информационно-справочные и поисковые системы:

информационные электронные ресурсы «консультант +», «гарант».

1. постановление правительства рф от 7 декабря 2000 г. 927 «о государственной поддержке развития фермерства и других субъектов малого предпринимательства в сельском хозяйстве» (с изм. И доп. От 1 февраля 2005 г.).

2. федеральный закон от 26 октября 2002 г. 127-фз «о несостоятельности (банкротстве)» (с изм. И доп. От 22 августа, 29, 31 декабря 2004 г. 24 октября 2005 г. 18 июля, 18 декабря 2006 г. 5 февраля, 26 апреля, 19 июля 2007 г.).

3. организация предпринимательской деятельности /под ред. С. и. грядова – м. колосс, 2005 – 416 с.

4. грядов с. и. теория предпринимательства м. колос, 2007.

5. нечаев в. и. рысьлятов а. з. предпринимательство: учебное пособие- м. колосс, 2008

6. бусыгин а. предпринимательство. Основной курс. – М. инфра – м, 1997

7. предпринимательство в апк /с. и. грядов, Терновых к с бизнес планирование на предприятиях апк практикум, и. т. крячков, Терновых к с бизнес планирование на предприятиях апк практикум, в. а. удалов и др. Под ред. С. и. грядова. – М. колос, 1997

1. горемыкин в. а. боголюбов о. а. экономическая стратегия предприятия. Учебник.- М. информационно-издательский дом «филинъ»,2008

2. осипова л.

в. синяева и. м. основы коммерческой деятельности

в. синяева и. м. основы коммерческой деятельности. Практикум: учебное пособие для вузов.- М.: банки и биржи, юнити, 2007

3. горемыкин в. а. бугулов э. р. боголюбов а. ю. планирование на предприятии. — М. «филинъ», 2008

4. горемыкин в. а. основы технологии лизинговых операции. – М. ось-89, 2008

5. иванова м. б. иванов м. ю. коммерческая деятельность: учебное пособие.- М.: роир, 2007

6. самочкин в. н. гибкое развитие предприятия: анализ и планирование.- М. дело, 2007

7. панкратов ф. г. серегина т. х. коммерческая деятельность: учебник-м. инфра-м, 2008

8. экономика и организация предпринимательства: учебно-методические материалы/российская академия государственной службы при президенте р. ф.

9. рубин ю. б. курс профессионального предпринимательства. Ч. 2. — киров, Терновых к с бизнес планирование на предприятиях апк практикум,2007

10. арустамов э. а. андреева р. с. организация предпринимательской деятельности. Основы бизнеса. Практикум. — М. дашков, Терновых к с бизнес планирование на предприятиях апк практикум, 2008

консультант плюс, гарант, gks. Ru, nalog. Ru, minfin. Ru, mcx. Ru, aris. Ru

экономика апк

гражданский кодекс российской федерации. М. гроссмедиа, 2007 – 496 с.

налоговый кодекс российской федерации. М. гроссмедиа, 2007 – 544 с.

трудовой кодекс российской федерации. М. элит, 2008 – 208 с.

гелета и. в. экономика организации (предприятия) / и. в. гелета, е. с. колинская, а. а. кофанов. – М: магистр, 2007. – 303 с.

волков о. и. экономика предприятия (фирмы) / под ред. О. и. волкова и о. в. девяткина. – М. инфра-м, 2008. – 604 с.

волков о. и. экономика предприятия / о. и

волков о. и. экономика предприятия / о. и. волков, Терновых к с бизнес планирование на предприятиях апк практикум, в. н. скляренко. – М. инфра-м, 2008. – 280 с.

жиделева в. в. экономика предприятия / в. в. жиделева, ю. н. коптейн. – М. инфра-м, 2008. – 133 с.

горфинкель в. я. экономика предприятия / под ред. В. я. горфинкеля. – М. юнити-дана, 2009. – 767 с.

ерохина л. и. башмачникова е. в. марченко т. и. экономика предприятия в сфере товарного обращения. М. кнорус, 2009 – 304 с.

нечаев в. и. парамонов п. ф. халявка и. е. экономика предприятий апк. Учебное пособие. Спб. Лань, 2010 – 464 с.

осколков м. л. экономика предприятия апк. Учебное пособие. Тгсха – тюмень, 2010 – 524 с.

сергеев и. в. экономика организаций (предприятий): электронный учебник / и. в. сергеев, Терновых к с бизнес планирование на предприятиях апк практикум, н. и. веретенникова. – М. кнорус, 2009

осколков м. л. практикум по «экономика сельскохозяйственных предприятий» и «экономика отраслей». – Тюмень, 2000. – 193 с.

горфинкель в. я. экономика предприятия / под ред. В. я. горфинкеля. – М. 2003. – 718 с.

осколков м. л. экономика предприятия апк / м. л. осколков. – Тюмень, 2004. – 612 с.

сафронов н. а. экономика организации (предприятия) / под ред. Н. а. сафронова. – М. экономистъ, 2004. – 618 с.

сергеев и. в. экономика предприятия / и. в. сергеев. – М. финансы и статистика, 2004. – 304 с.

волков о. и. экономика предприятия (фирмы) / под ред. О. и. волкова и о. в. девяткина. – М. инфра-м, 2005. – 601 с.

http.//Www. Online. Ru/spliet

http.//Www. Online. Ru/spliet

http.//Www. Cemi. Rssi. Ru/

http.//Www. Ecfor. Cemi. Rssi. Ru/

http.//Www. Citycat. Ru/finance/catalog

http.//Www. Akdi. Ru/

пиличев н. а. управление агропромышленным производством. — М. колос, 2000 — 296 с. (учебники и учебные пособия для студентов высш. Учеб. Заведений)

котлер ф. основы маркетинга. М. прогресс, 2008г

маркетинг: учебник / а. н, романова, ю. ю. корлюков, Терновых к с бизнес планирование на предприятиях апк практикум, с. а. кра-сильников и др. / Под ред. А. н. романова. М. банки и биржи, юнити, 2005

информационно-консультационная служба в апк. Учебное пособие (сборник учебных материалов) под ред. В. м кошелева, в. в. маковецкого – м. агроконсалт. 2001.

финансовый менеджмент. Под ред. Самсонова н. ф. — м. юнити, 2002

менеджмент в апк / ю. б. королев, Терновых к с бизнес планирование на предприятиях апк практикум, в. д. коротнев, Терновых к с бизнес планирование на предприятиях апк практикум, г. н. кочетова и др. — М. колосс, 2007. -424 с: ил. (Учебники и учеб. Пособия для студентов высш. Учеб. Заведений).

минцбсрг г. структура в кулаке: создание эффективной организации / пер. С англ. Под ред. Ю. н. каптуревского. — Спб. Питер, 2002. — 512 с: ил.

томпсон-мл. Артур, а. стрикленд ш, а. дж. Стратегический менеджмент: концепции и ситуации для анализа, 12-е издание: пер. С англ. -М. издательский дом «вильяме», 2002. — 928 с: ил. -Парал. Тит. Англ

современные теории управления: теории менеджмента на пороге xxi века: учеб. Пособие/ в. ю. пашкус, н.

а. пашкус, з. а. савельева; под ред. В. ю. пашкуса

а. пашкус, з. а. савельева; под ред. В. ю. пашкуса.-Спб. Изд. Дом "сентябрь"; изд. Дом "бизнес-пресса", 2003.-272с

7 нот менеджмента: настольная книга руководителя.-5-Е изд.-М. зао "журнал эксперт"; ооо "изд-во эксмо", 2002.- 656с.

оценка эффективности деятельности компании: практ. Рук-во по использованию сбалансированной системы показателей/ н-г. ольве, ж. рой, магнус в.; пер. С англ.-М. изд. Дом "вильяме", 2004.- 304с: ил.

чернов с. е. абаимова м. б. менеджмент: концепции и методы стратегического управления. -М, инэп, 2002.

карьера менеджера/л. якокка, у. новакшер. С англ.- 3-Е изд. — Мн. Ооо «попурри», 2004. -416 с. — (серия «успех»)

управление персоналом организации: учебник (под ред. Проф. Кибанова а. я.) м. инфра-м, 2001. 540 стр.

портер, майкл, э. конкуренция. Пер. С англ. М. издательский дом «вильяме», 2003. — 496 с. ил. — Парал. Тит. Англ.

смирнов эа. Управленческие решения. М. инфра-м, 2001 г. 264 стр.

басовский л. е. протасьев в. б. управление качеством: учебник. М. инфра-м, 2001 г. 212 стр.

антикризисное управление: учебник (под ред. Проф. Короткова э. м.), м. инфра-м, 2001 г. 432 стр.

интернет-ресурсы:

www. Mcx. Ru — официальный сайт министерства сельского хозяйства рф

www. Economy. Gov. Ru — официальный сайт министерства экономического развития и торговли рф

http:// research. Rbc. Ru — представлена текущая информация и аналитические материалы о. состоянии рынков товаров и услуг.

www. Ptpu. Ru — международный журнал «проблемы теории и практики управления». На сайте можно найти много интересных статей, касающихся различных вопросов управления предприятием (в т.

ч. инвестиционной и инновационной деятельностью

ч. инвестиционной и инновационной деятельностью).

http:// marketsurveys. Ru — обзоры и маркетинговые исследования

российского и мирового товарных рынков.

www. Bkg. Ru — материалы российской консультационной компании bkg, специализирующейся на решении задач, связанных с совершенствованием бизнес-процессов, Терновых к с бизнес планирование на предприятиях апк практикум, развитием и увеличением эффективности бизнеса.

www. Cnn. Ru — корпоративный менеджмент. Сайт предоставляет методическую и аналитическую информацию, относящуюся к управлению компаниями, финансам и маркетингу. Содержит аналитические статьи, книги и курсы лекций, бизнес-планы реальных предприятий, руководства, ссылки на другие источники информации в интернет.

www. Rbc. Ru — риа «росбизнесконсалтинг». Самая свежая информация о состоянии финансовых и товарных рынков (российских и мировых), новостные ленты. Аналитические материалы, обзоры финансовых рынков.

периодические издания:

журналы: «менеджмент», «менеджмент в россии и за рубежом», «эксперт», «экономика сельскохозяйственных и перерабатывающих предприятий»,

.

Твердотопливный котел кву-750 автоматик-лес руководство по эксплуатации

Твердотопливный котел кву-750 автоматик-лес руководство по эксплуатации — этому посвящена статья этого сайта.

 

Твердотопливный котел кву-750 автоматик-лес руководство по эксплуатации

 

руководство по эксплуатации

руководство по эксплуатации

вы приобрели котел >энергия тт>, являющийся рекордсменом по продолжительности горения одной загрузки без ручного обслуживания. Это надежная отопительная установка для обеспечения теплом жилых и нежилых помещений и строений, работающая практически на любом виде угольного топлива. Чтобы по достоинству оценить уникальные параметры котла, вам следует выполshy; нять определенные требования к его установке и эксплуshy; атации, чтобы обеспечить его эффективную работу, вашу личную безопасность и сохранность вашего имущества.

1. общие указания

1.1. до установки на место котел должен храниться в сухом, закрытом помещении.

1.2. перед установкой котла ознакомьтесь с настояshy; щим >руководством> и соотнесите его с фактическими условиями установки и эксплуатации.

1.3. проверьте соответствие намеченного места устаshy; новки котла техническим условиям; определите, будете ли вы использовать существующий дымоход или смонтиshy; руете отдельную дымовую трубу. Иными словами, чтобы вся система надежно и безоshy; пасно работала, разработку проекта установки и его исполнение должны быть поручены специалистам, знакомым с этими работами.

1.4. монтаж и последующую эксплуатацию котла веshy; дите с учетом всех требований настоящего >руководстshy; ва> и >типовых правил пожарной безопасности для жиshy; лых домов>.

1.5. следует иметь в виду, что конструкция котла поshy; стоянно совершенствуется, вследствие чего конструктивshy; ные решения отдельных узлов могут незначительно отshy; личаться от данного описания.

2. назначение котла

2.1. котел >энергия тт> предназначен для отопления и горячего водоснабжения жилых и административных зданий, теплиц, гаражей, складов, Твердотопливный котел кву-750 автоматик-лес руководство по эксплуатации, производственных помещений и т.

п. сооружений, оборудованных системаshy

п. сооружений, оборудованных системаshy; ми водяного отопления непрерывного действия как с естестshy; венной циркуляцией воды без циркуляционного насоса, так и с принудительной с насосом.

2.2. конструктивные особенности котла позволяют в зависимости от вида и сорта угольного топлива и необходимой интенсивshy; ности нагрева помещений обеспечить его многодневную непрерывную работу без дозаправки топливом, что являshy; ется его существенным преимуществом. Отсутствие в процессе работы открытых дверок топки и зольника деshy; лают его безопасным в пожарном отношении.

2.3. котел >энергия тт> предназначен для работы на каменном или буром угле, антраците калорийностью 4000-8000 ккал/кг при любой зольности, а также на угольных брикетах. Следует иметь ввиду, что максимальная мощность котла зависит от фракции применяемого угля. Чем мельче уголь, тем меньшую мощность может выдать котел из-за за сопротивления подаче воздуха в очаг горения. Оптимальная фракция применяемого угля ndash; 25-50 мм. Не следует применять крупные куски (свыше 60 мм), так как при этом снижается эффективность сжигания и ухудшается его управляемость.

3. указание мер безопасности

3.1. при установке котла на сгораемый пол под котshy; лом и вокруг него на расстоянии 50 см. Необходимо положить стальной лист толщиной не менее 0,5 мм по асбестовому картону или войлоку, пропитанному глинистым раствоshy; ром!

3.2. расстояние от боковой поверхности котла до стен помещения должно быть не менее 0,5 м, а перед фронтом не менее 1,25 м.

3.3. необходимо обратить особое внимание на место прохода дымовой трубы через стены и поshy; толки помещения, обеспечив необходимую защиту этих конструкций от перегрева, а само место соединения котла с дымоходом тщательно уплотнить.

3.4. при монтаже котла, необходимо предусмотреть шибер на дымоходе, который категоричесshy; ки запрещается полностью перекрывать во избежание отравления окисью углерода.

3.5. песочный затвор загрузочной крышки заполнять только хоshy; рошо просеянным речным песком.

3.6. не допускается закипание воды в котле. Темпеshy; ратура воды на выходе не должна превышать 90deg; с.

3.7. при использовании котла >энергия тт> в закрытой системе на подающем патрубке котла должна быть установлена группа безопасности со сбросным клапаном, установленном на 2 бар.

3.8. следует периодически проверять заполнение сисshy; темы водой, следя за ее уровнем по переливу из расшиshy; рительного бачка, если применяется открытая система. Если применяется закрытая система, то автоматическая подпитка производится через редуктор давления, установленный на 1-2 атм. (Бар). запрещено доводить давление в котле свыше 2 бар. Давление свыше 3 бар приводит к смятию внутреннего цилиндра котла.

3.9. не применять для растопки котла легко воспламеshy; няющиеся жидкости.

3.10. не рекомендуется после начала эксплуатации котла надолго сливать с него теплоноситель во избежание ускоренной коррозии внутренней полости водяной рубашки.

3.11. котел >энергия тт> пожаробезопасен, поскольку эксплуатируется при постоянно закрытых дверках зольника.

4. устройство котла

котел >энергия тт> представляет собой сварную

котел >энергия тт> представляет собой сварную конструкцию цилиндрической формы. Его основными частями являются:

4.1. корпус с водяной рубашкой, оборудованный автоматизированной системой управления горением, ревизионной зольной дверцей (верхней) и нижней зольной дверцей для розжига котла и удаления шлака.

4.2. топливник, представляющий собой корпус котла, в котором находятся газоходы с эжекционными каналами, благодаря которым происходит принудительный захват дымогазов и подача воздуха в очаг горения.

4.3. проточная непрогораемая колосниковая трубчатая решетка находится в нижней части котла, сквозь которую шлак попадает в зольник, являющийся продолжением корпуса котла.

5. установка котла

5.1. при размещении котла в помещении необходимо выполнить требования, изложенные в разделе 3.

5.2. для создания небольшой тяги и разрежения в режиме останова дымососа, дымовая труба должна быть высотой не менее 3 м от уровня колосниковой решетки, а сам котел расположен в нижней части помещения или в подвале. Корпус дымососа с выходным дымовым патрубком диаметром 159 мм. Позволяет выполнить подсоединение к дымоходу сечением 150 или 160 мм.

5.3. трубы не должны иметь сужений, щелей и трещин.

5.4. сочленение дымоотводящего патрубка корпуса дымососа с дымовой трубой должно быть плотным.

5.5. выходящий патрубок корпуса дымососа плотно вставляется в дымоход котла, с нанесенным предварительно слоем термостойкого герметика.

5.6. контроллер котла крепится на любое удобное место в котельной, на расстоянии от котла, ограниченном длиной провода термодатчика и защищенное от высокой температуры. Термодатчик контроллера вставляется в предусмотренное отверстие в котле, находящееся на горизонтальной поверхности корпуса котла возле выхода дымового патрубка котла. Подробное описание функций контроллера прилагается.

5.7. котел устанавливается на бетонное основание или на металлический лист (если пол сгораемый), как описано в разделе 3 и его нижняя часть, примыкающая к полу или металлическому листу промазывается термостойким герметиком изнутри или снаружи котла.

5.8. в нижней части дымовой трубы необходимо преshy; дусмотреть закрывающееся отверстие для периодичесshy; кой чистки трубы от сажи.

5.9. все работы по монтажу системы необходимо поруshy; чить квалифицированной бригаде, знакомой с ее устройshy; ством. Помните, что только правильно смонтированная система обеспечит надежную работу котла.

6. работа котла

6.1. котел является отопительным агрегатом непреshy; рывного действия при периодической загрузке топлива и выноса шлака.

6.2. розжиг котла осуществляется в следующем порядке:

а) через верхнюю ревизионную зольную дверцу

а) через верхнюю ревизионную зольную дверцу на колосники равномерно укладывается 3-4 кг сухих дровяных поленьев.

б) затем засыпается уголь до полного объема. Если применяется мелкий уголь, то во избежание его просыпания через колосниковую решетку после прогорания дров необходимо сначала засыпать слой крупного угля, затем мелкого. Если вместо дров используются брикеты, то на них можно сразу насыпать мелкий уголь.

в) загрузочная крышка закрывается, укладываясь на предварительно насыпанный песок в промежуток между ободами загрузочного отверстия.

г) через открытую нижнюю зольную дверцу в зольник укладывается скомканный лист бумаги, на который кладутся несколько тонких щепок, потом покрупнее и сверху 3-4 кг. Древесных сухих поленьев.

д) включается контроллер. Заданная температура устанавливается 70 град. Дымосос должен заработать, создавая разрежение в котле и обеспечивая тем самым подачу воздуха через открытую нижнюю зольную дверцу.

е) в зольнике снизу поджигается бумага и щепки. Нижняя дверца зольника не закрывается. По мере разгорания заложенного топлива в зольнике, горение передается дровам или брикетам, расположенным на колосниковой решетке. При розжиге мощность дымососа рекомендуется установить на контроллере 100. при достижении температуры воды в котле 60 град. Проверьте, загорелся ли уголь. Если нет, подкладывайте поленья, пока горение не передастся углю. Убедившись, что нижний слой угля загорелся, установите желаемую температуру подачи на контроллере, мощность дымососа установите соответственно фракции применяемого угля (чем крупнее уголь, тем меньше мощность), закройте нижнюю зольную дверцу и установите положение задвижек соответственно создаваемому разрежению в трубе дымохода (чем сильнее естественная тяга, тем больше прикрыты задвижки).

6.3. по мере окончания закладки угля не требуется повторный розжиг до окончания отопительного сезона. Необходимо только периодически производить дозагрузку котла углем и выемку шлака через нижнюю зольную дверцу. Это должно происходить в следующей последовательности:

а) как только потребуется засыпать новую

а) как только потребуется засыпать новую порцию топлива, устанавливаете на контроллере мощность дымососа 100 и закрываете обе задвижки на нижней зольной дверце для создания наибольшего разрежения в котле во избежание выхода дымогазов в помещение при открытой загрузочной крышке. Если дымосос находится в режиме поддержания заданной температуры и работает на малых оборотах при заданной 100 мощности, установите желаемую температуру теплоносителя на 5-10 град выше, чтобы дымосос набрал максимальные обороты.

б) открываете загрузочную крышку и засыпаете новую порцию топлива. Закрываете крышку, убедившись, что песочный затвор не содержит кусочков угля и в нем достаточно песка для обеспечения герметичности. Закрываете крышку.

в) открываете нижнюю зольную дверцу, металлическим совком удаляете шлак, также кочергой прочесываете между трубами колосниковой решетки для просыпания застрявшего шлака в зольник до появления раскаленных угольков. Также удаляете. Нижнюю дверцу закрываете, а задвижки на ней устанавливаете в рабочее положение (открытое).

дозагруженный таким образом котел продолжает работать, но на некоторое время произойдет снижение температуры теплоносителя, так как часть тепла передастся новой холодной порции угля и потребуется время для установления температурного режима. Это может длиться от одного часа до нескольких часов в зависимости от фракции и теплотворной способности применяемого топлива.

если вы применяете рекомендованную фракцию

если вы применяете рекомендованную фракцию угля 25-50 мм. То весь период сжигания разовой загрузки (5-20 дней) вам не потребуется обслуживать котел, все сделает автоматика. Но если вы будете использовать мелкую фракцию угля, штыб, пыль, то во избежание снижения температуры придется раз в 2-3 суток прочесывать колосники от золы через нижнюю зольную дверцу.

на дровах данный котел использовать не рекомендуется, так как из-за малой насыпной плотности, низкой теплотворной способности и интенсивного выделение дегтя из дров сводятся на нет уникальные параметры данного котла по длительности горения. Кроме того, интенсивное отложение смолистых соединений на стенках котла и крыльчатке дымососа может привести не только к быстрому выходу из строя автоматики, но и ощутимому снижению эффективности теплообмена.

dakon

viadrus

чешский завод viadrus — одно из старейших и самых известных предприятий в отрасли. История предприятия начинается с основания в 1885 году металлургического комбината.

в 1890 начат выпуск литых чугунных радиаторов. Высокое качество чугунного литья позволило расширить производственную программу и в 1928 году начать выпуск чугунных котлов. Компания быстро завоевала известность, как производитель котлов-агрегатов, Твердотопливный котел кву-750 автоматик-лес руководство по эксплуатации, работающих на жидком и твердом топливе.

в 1946 введены в эксплуатацию 2 новых цеха: цех по производству цветных металлов и сталелитейный цех, что существенно расширило возможности производителя. Опираясь на совершенную производственную и конструкторскую базу. Предприятие начинает в 1967 году производство газовых котлов.

в 1973 году проведена полная комплексная модернизация производства котлов и радиаторов. В настоящее время завод viadrus выпускает отопительную технику в диапазоне мощностей от 2,5 квт до 500 квт, теплообменники, горелки и радиаторы. Завод выпускает продукцию не только под собственной торговой маркой, но и выполняет заказы на комплектующие от ведущих производителей отопительной техники из чехии, словакии, германии. Применяемые материалы и комплектующие являются гарантией высокой эффективности, надежности и долговечности котлов и радиаторов viadrus.

с 1993 года завод viadrus является держателем

с 1993 года завод viadrus является держателем сертификатов системы управления качества согласно iso 9001 и с 1997 года системы экологического управления согласно iso 14001

wichlacz

oбогревательные двухдневные котлы (печи)

в комплект поставки котла входит следующее: электронный регулятор температуры, инструкция обслуживания; вентилятор циркуляции воздуха синхронного действия с регулированием; инструкция обслуживания котла.

печь (ее корпус и основные части) изготовлена из стальных листов и металлических труб. Листовая сталь высшего качества специально изготовлена для настоящей продукции. Стенки корпуса котла — целостные стальные элементы без пайки. Такая технология (т. е. отсутствие щелей и прорезов) значительно увеличивает прочность и долговечность работы котла. Центральная часть корпуса изготовлена из стали, толщиной 6 мм, внешняя часть корпуса спереди и сзади 6 мм, внешняя часть корпуса с двух сторон 6 мм.

обогревательные каналы

обогревательные каналы находятся сразу же над местом сожжения топлива, для полного исключения возникновения дыма. Продукты сгорания не распространяются хаотически, а поднимаются снизу вверх (в отличие от других котлов). таким образом, достигаются лучшие результаты при работе котла.

новаторский подход заключается в наличии внутри котла труб (вместе с дополнительной закругленной формой обогревательных каналов), для сохранения и увеличения энергии во время работы на 2/3 его объема. Тормозится перемещение тепловой энергии, что способствует постоянному обогреву в системе отопления с данным котлом.

эффективность работы кпд

эффективность работы кпд

рекламируемого котла — 89, в отличие от других (порядка 80). гарантия производителя дается на 2 года. Угроза аварий в течение года остается на уровне

0,5. такой результат позволяет использовать различные материалы высокого качества для

розжига котла и следующие технические новинки:

bull; свободная циркуляция (система регулирует количество газов в печи и препятствует

авариям);

bull; >сухая> работа печи-котла (заключается в наличии внутри котла труб вместе с

дополнительно)’.

округленной формой обогревательных каналов, Твердотопливный котел кву-750 автоматик-лес руководство по эксплуатации, препятствующих вредным испарениям и осадком в трубах и каналах);

bull; при изготовлении труб каналов использован молибден, который надежно охраняет сталь

от ржавчины и

вредных субстанций;

bull; >мокрые> прутья нагревания не припаливаются благодаря воде, поступающей из системы

отопления и

снижающей температуру;

bull; технология без пайки и отсутствие внешних щелей и прорезов;

bull; применение стальных листов большей толщины и труб высшего качества.

работа в течение 2-х дней

основное преимущество такой системы — работа в течение 2 дней, постоянная поддержание температуры благодаря объемной камере сгорания. Объем камеры сгорания увеличен на 100. это позволяет регулировать процесс горения в течение суток без добавления новых партий топлива. Первый цикл начинается полной загрузкой топлива в камеру и заканчивается уборкой пепла. Одноразовая загрузка сырья достаточна на двое суток. Поэтому котел не требует

постоянного наблюдения со стороны пользователя в течение 48 часов. Второе преимущество — медленное горение. Энергетическая ценность сырья используется эффективно благодаря правильному направлению потока воздуха на горящее топливо.

усовершенствованная система подачи воздуха

усовершенствованная система подачи воздуха

эта система действует при помощи принудительной подачи воздуха синхронного действия с электрорегулированием.

bull; прямое поступление воздуха направлено на верхнюю часть горящего сырья;

bull; многопунктовое поступление воздуха направлено на боковые части горящего сырья, что обеспечивает медленное горение.

точное направление движения воздуха в камере обеспечивают специальные отверстия — форсунки. Они установлены так, чтобы воздух непосредственно достигал топлива. Эти самоочищающиеся отверстия никогда не загрязняются и не забиваются даже при сожжении мусора. Общее количество форсунок зависит от размера котла, например, в печи 3,5 м их 16 шт.

система поступления и циркуляции воздуха действует синхронно с регуляторами проникновения воздуха в печь. Благодаря этому возможно регулирование воздушного потока в зависимости от желания пользователя.

основные преимущества системы поступления воздуха

направленное движения воздуха в камере обеспечивает полное сгорание различного топлива.

низкий уровень выброса газов

выброс пепла, тепловой энергии в атмосферу полностью исключен благодаря оптимальной дозировке поступления воздуха в печь.

быстрая растопка котла

в начале растопки используется 80 системы дозировки поступления воздуха в печь. В течение примерно 20 мин. Печь достигает заданной температуры.

наш котел — уникальное торговое предложение, единственное на рынке товаров! До настоящего времени не производились печи для длительного горения, управляемые так же, как котлы на газообразном и жидком топливе. Наша цель — эффективность работы при одноразовой загрузке сырья на двое суток, поэтому котел не требует постоянного наблюдения со стороны пользователя в течение 48 часов. Это удачный технический проект. Печь свободно достигает температуры от 35 до 95 deg; с. существует возможность плавной регулировки (увеличение и снижение) температуры в ручном режиме и с помощью комнатного регулятора температуры, погодного регулятора.

котел экономит до 30 топлива по сравнению

котел экономит до 30 топлива по сравнению с применением газообразного или жидкого

топлива.

удобства эксплуатации

эксплуатация котла максимально упрощена, удобна, имеет ряд преимуществ:

bull; загрузка 1 раз в течение двух дней;

bull; широкий наклонный люк, удобный для обслуживания и загрузки топлива

bull; не требует постоянной чистки, достаточно 1 раз в месяц убрать с каналов и труб пыль, которая легко удаляется.

bull; внутреннее пространство и отдельные части печи не собирают пыль и пепел;

для нашего котла применимы различные виды твердого топлива — уголь, угольные отходы, угольные концентраты, древесные материалы, дрова.

конструкция и запуск угольных котлов «прометей автомат»

наш автоматический котел состоит из трех основных конструкционных элементов:

загрузочный бункер, который заполняется топливом, из которого топливо поступает в котел.

корпус котла, в котором происходит процесс горения и находится теплообменная часть. В корпусе также расположены все основные элементы механики и автоматики.

зольник, служит для накопления золы.

для запуска автоматического угольного котла «прометей автомат» в работу, необходимо заполнить бункер углем и плотно закрыть крышку. Растопка котла производится через специальный люк с помощью нескольких деревянных щепок.

через несколько минут, котел переходит в автоматический режим работы. Блок управления полностью регулирует процесс горения, согласно заданным параметрам. Шаговый двигатель, с помощью системы рычагов, Твердотопливный котел кву-750 автоматик-лес руководство по эксплуатации, непрерывно вращают поворотный колосник, что обеспечивает, равномерный расход топлива. Интенсивность горения регулируется дымососом, за счет создаваемого в топке разряжения.

загрузочный бункер большого объема позволяет

загрузочный бункер большого объема позволяет загружать уголь не чаще чем один раз в неделю, а автоматический режим работы и регулировки процесса горения позволяют экономить топливо. Благодаря максимальной автоматизации котла, участие человека требуется только при загрузке топлива и редком удалении золы, все остальное делает автоматика. Даже после отключения электричества и остановки работы автоматического котла, уголь в топке продолжает медленно тлеть несколько суток, что позволяет возобновить работу оборудования без повторного запуска.

оснащенный термостатом, автоматический угольный котел «прометей автомат» по удобству и эффективности подобен газовым котлам. Владельцу нужно лишь выставить температуру, которую необходимо поддерживать в помещении, а потом 1-2 раза в неделю дозагружать бункер углем.

преимущества наших автоматических твердотопливных котлов на угле

отличная альтернатива газу. Полностью автоматизированный процесс сжигания, высокий кпд и эксплуатационный комфорт, приближенный к газовым или дизельным котлам.

.

Инструкция раций vector h-pwr

У нас вы узнаете о Инструкция раций vector h-pwr.

 


 

Инструкция раций vector h-pwr

 

vector vt-44 h-pwr безлицензионная lpd

vector vt-44 h-pwr безлицензионная lpd/pmr рация

vector vt-44 h-pwr безлицензионная рация lpd+pmr диапазонов

vector vt-44 h / vector vt-44h-pwr — портативная радиостанция lpd диапазона профессионального форм-фактора, в ударопрочном и брызгозащищенном исполнении, радиостанция относится к безлицензионному классу и не требует регистрации и получения выделенных радиочастот.

технические характеристики рации vector vt-44 h:

комплект поставки портативной радиостанции vector vt-44 h-pwr:

оригинальные аксессуары для носимой радиостанций vector vt-44 h:

радиостанция lpd/pmr

спасибо вам за приобретение радиостанции vector. Мы уверены, что эта качественная, простая в эксплуатации радиостанция обеспечит вам надежную связь.

прежде чем приступить к эксплуатации радиостанции необходимо внимательно прочитать настоящее описание.

комплект поставки

может меняться в зависимости от версии.

подготовка к эксплуатации

заряд аккумулятора

перед использованием радиостанции vector vt-44 h необходимо зарядить аккумулятор.

мы знаем, где купить рации vector h pwr дешево. И мы вам подскажем! Сравни цены на рации vector h pwr в интернет-магазинах и сэкономь на что-нибудь приятное.

заказ и продажа товаров рации vector h pwr производится с доставкой в москву, санкт-петербург, екатеринбург или любой другой город россии. Подробную информацию о доставке и гарантии уточняйте в магазинах.

купите рации vector h pwr по недорогой

купите рации vector h pwr по недорогой цене прямо сейчас, сравнив отзывы покупателей, описания, технические характеристики, фото, доступные цвета, а также комплектацию.

.

Как самому поменять обшивку салона

Как самому поменять обшивку салона — этому посвящена страница этого сайта.

 


 

Ozon.ru

 

volkswagen bora still rolling./ › Бортжурнал

volkswagen bora still rolling./ › Бортжурнал › замена обшивки салона автомобиля. Серия первая.

долго собираясь силами решил снять оббивку салона.

двери, стойки и потолок.

предворительно читал много форумов, Как самому поменять обшивку салона, о том как вытащить потолок при этом не поломать его. Но хочу сказать, то это была самая маленькая проблема. Я больше возился с анти-солнечными козырьками чем с самим потолком.

обшивка дверей разобрана на 2 части. Рамка, которая имеет большую площадь, и тканевое покрытие вокруг ручек. Вот именно его и буду перетягивать.

задумка заключается в том, что бы добавить в салон красок. По этому в цвет потолка и дверей выбран — красный. А стойки между ними будут черными. Пластиковые элементы на потолке, наверное тоже будут менять свой цвет в черный. Ну это покажет время.

все снятые пластмасовые детали промыл в ванной с мылом и просушил на балконе. Предыдущий хозяин не слишком заботился о чистате и порядке.

продолжение следует.

; не переключайтесь!; (С) малохов:))

обшивку салона машины можно поменять или отремонтировать

без сомнения салон страдает и подвергается неудобствам больше, нежели все остальные составляющие автомобиля. Это ясно, ведь именно салон предназначен для перевозки людей. Помимо того, что мы находимся внутри салона, мы там можем кушать, курить, пользоваться губной помадой и духами, а иногда можем чистить обувь.

очень красивый салон автомобиля

порой наши дети играются и балуются в салоне автомобиля. А если нам необходимо что-то перевести, салон автомобиля незамедлительно превращается в кузов грузовика, а особенно если мы едем за город: на пикник или на дачу. Конечно, все наши действия в салоне нашей машины не проходят бесследно для салона.

царапины на пластике. Масляные жирные пятна

царапины на пластике. Масляные жирные пятна, трещины и потертости на подлокотнике, «пропалы» от сигарет на обивке сидений, большие и маленькие дыры – все это знакомая ситуация для каждого автовладельца. Смысла искать виновных уже нет, а вот подумать о том, как сделать ремонт обшивки салона автомобиля следует.

существует два варианта проведения ремонта обшивки салона автомобиля. Первый вариант – заехать на специализированную мастерскую, оставить там машину и ехать домой за деньгами. Счет за замену обшивки салона будет немаленький. Помимо довольно недешевых материалов в счет будет включена работа мастеров. Второй вариант 8212; произвести ремонт обшивки салона автомобиля своими руками. Если вы все же склоняетесь к первому варианту, советуем дочитать до конца, и быть может, вы передумаете, что позволит вам сэкономить значительную сумму.

замена обшивки салона автомобиля своими руками

автомобилисты, которые решили производить замену обшивки салона самостоятельно должны отдавать отчет, что процедура ремонта не такая легкая, как может показаться на первый взгляд. Для этого необходимо время, специальные материалы и инструменты, а также внимательность и терпение. Но результат будет поистине желанным. Что может быть приятнее нового салона, да еще, если он сделан своими руками? Заодно такой процесс послужит вам уроком того, что салон машины следует беречь не менее, нежели коробку передач или сцепление.

безусловно, самостоятельная замена обивки

безусловно, самостоятельная замена обивки обойдется в два раза вам дешевле. Подбирать материалы и ремкомплекты для замены обшивки следует исходя их того, какая часть обшивки автомобильного салона является поврежденной. Для того чтобы произвести качественный ремонт обшивки салона самостоятельно, необходим профессиональный инструмент.

инструмент

на сегодняшний день авторынок предлагает для ремонта автомобилей довольно недорогие профессиональные наборы. Стоимость наборов будет зависеть от производителя и количества инструментов в наборе. В набор входят приспособления и инструменты, которые предназначаются для демонтажа деталей и самой обшивки салона, для снятия автомагнитол, дверных карт, молдингов и деталей панели приборов.

для сведения к минимуму механических повреждений пластиковых деталей лопатки для демонтажа изготовлены из полиуретана. В набор также включены: ключи для снятия климат-контроля и вилка для произведения демонтажа пистонов. При своей приемлемой цене такой набор для замены обшивки салона, безусловно, вам пригодится. Также плюсом является то, что инструменты в основном предназначены для произведения ремонта в салоне любой модели автомобиля.

материалы

подбор материалов необходимо производить исходя из объема ремонта и степени повреждения салона автомобиля. Для разных материалов отделки необходимы соответствующие ремкомплекты.

для кожи. Ремонт кожаного салона является

для кожи. Ремонт кожаного салона является несколько сложной процедурой, как в финансовом плане, так и по времени. В основном для проведения ремонта салона из кожи понадобится «жидкая кожа». Процесс является многоразовым. Места повреждений необходимо несколько раз покрывать ремматериалом. В виниловом или кожаном салоне для заполнения повреждений следует применять отвердитель, по типу b-compound. Затем при помощи специального геля следует снять слепок рисунка вашего кожаного салона, и эту пленку наложить на отремонтированный участок.

ремонт кожаного салона (до и после)

для ткани. В основном это велюровый салон. Замену обивки салона следует осуществлять при помощи самой ткани. Такая процедура является несколько сложнее, чем ремонт обшивки салона. Тут понадобятся навыки швеи выкройки, их можно сделать, используя старые элементы обшивки.

процесс замены тканевой обшивки салона

ремонт обшивки салона следует производить при помощи ремкомплектов волокон с многообразным количеством цветов с целью подбора колора. На место повреждения следует наносить спецклей, на который затем необходимо при помощи кисточки или распылителя нанести волокна, которые является одинаковой с салоном цвета и текстуры. На место ремонта затем нужно нанести специальную тефлоновую пленку и произвести термическую обработку утюгом.

для пластика. Ремонт обшивки салона автомобиля для пластиковых деталей следует производить с помощью геля-пластификатора, например прозрачный b-gel. Определенная зернистость в основе геля дает возможность с точностью воспроизвести текстуру поверхности, которая подлежит ремонту. У геля-пластификатора сильные свойства по склеиванию поверхностей из пластика. После его применения довольно тяжело отличить заводскую деталь. От той, которая подлежала ремонту.

ремонт пластиковых деталей (до и после

ремонт пластиковых деталей (до и после)

в продаже есть обширный выбор материалов для проведения ремонта обивки материала своими руками, особенно это касается пластика. Лучше если вы будете обращаться в магазины, которые специализируются на продаже автохимии. Поскольку на авторынке вам могут предложить материал для обшивки салона от неизвестного производителя, после применения, которого необходимо будет производить полную замену салона машины.

технология

технология действий у разных производителей материалов для ремонта салона авто довольно схожа, но при применении существуют также и свои нюансы. Поэтому самым надежным и правильным вариантом перед ремонтом обшивки салона является изучение инструкции производителя.

в основном реставрация салона из материала и пластиковых покрытий осуществляется по одной технологии: поврежденное место устраняется с помощью ремматериалов.

что касается кожаных салонов, Как самому поменять обшивку салона, то тут можно воспользоваться другой технологией ремонта автосалона – покраской, но для этого все-таки стоит быть уверенным в своих силах. Если нет, то лучше не рискуйте и доверьте этот процесс специалистам.

видео 8212;  ремонт велюра и ткани в салоне автомобиля

видео 8212; ремонт салона легкового автомобиля

стильный салон для ваз 2105

как самому сменить обшивку потолка н ваз-2107 как только я как поменять обшивку потолка ваз 2101 купил машину, я натяжка потолка ваз 2104 хотел поставить в kak delot obivki vaz 2106 нее хорошую музыку. Как покрасить потолок в машине ваз 2101 для этого неминуемо как самому сменить обшивку потолка н ваз-2107 пришлось бы ставить как поменять обшивку потолка ваз 2101 передние колонки. Из- натяжка потолка ваз 2104 за особенности компоновки kak delot obivki vaz 2106 дверей в жигулях как покрасить потолок в машине ваз 2101 мне не удавалось как самому сменить обшивку потолка н ваз-2107 найти колонки подходящей как поменять обшивку потолка ваз 2101 глубины, чтобы они натяжка потолка ваз 2104 влезали без переделок.

kak delot obivki vaz 2106 так же хотелось

kak delot obivki vaz 2106 так же хотелось как покрасить потолок в машине ваз 2101 обеспечить приличное звучание. Как самому сменить обшивку потолка н ваз-2107 значит надо ставить как поменять обшивку потолка ваз 2101 подиумы. Походив порынкам, натяжка потолка ваз 2104 я не нашел kak delot obivki vaz 2106 достойных вариантов: пластик как покрасить потолок в машине ваз 2101 однозначно отвергался, а как самому сменить обшивку потолка н ваз-2107 деревянные ‘кругляши’-проставки, как поменять обшивку потолка ваз 2101 обитые карпетом не натяжка потолка ваз 2104 вписывались в кожезаменительную kak delot obivki vaz 2106 картину салона пятерки. Как покрасить потолок в машине ваз 2101 при этом они как самому сменить обшивку потолка н ваз-2107 сильно торчали в как поменять обшивку потолка ваз 2101 салон, мешали входу/ натяжка потолка ваз 2104 выходу, а так kak delot obivki vaz 2106 же задевали за как покрасить потолок в машине ваз 2101 ручку открывания дверей. Как самому сменить обшивку потолка н ваз-2107 меня это не как поменять обшивку потолка ваз 2101 устраивало. Решено было натяжка потолка ваз 2104 не только врезать kak delot obivki vaz 2106 колонки, но и как покрасить потолок в машине ваз 2101 расположить ручку открывания как самому сменить обшивку потолка н ваз-2107 в более удобное как поменять обшивку потолка ваз 2101 место, при этом натяжка потолка ваз 2104 сделать обивку мягкой, kak delot obivki vaz 2106 как на иномарках. Как покрасить потолок в машине ваз 2101 так же хотелось как самому сменить обшивку потолка н ваз-2107 сменить черноту внутренних как поменять обшивку потолка ваз 2101 обивок на более натяжка потолка ваз 2104 веселый цвет. На kak delot obivki vaz 2106 черном фоне вся как покрасить потолок в машине ваз 2101 грязь и пыль как самому сменить обшивку потолка н ваз-2107 была как на как поменять обшивку потолка ваз 2101 ладони — что зимой, натяжка потолка ваз 2104 что летом. Итак, kak delot obivki vaz 2106 я определил задачи:

1. как покрасить потолок в машине ваз 2101 установить проставки под как самому сменить обшивку потолка н ваз-2107 колонки, и собственно как поменять обшивку потолка ваз 2101 колонки

2. перенести ручки натяжка потолка ваз 2104 открывания дверей

3. сменить kak delot obivki vaz 2106 обивку, ее фактуру как покрасить потолок в машине ваз 2101 и цвет.

часть 1. как самому сменить обшивку потолка

часть 1. как самому сменить обшивку потолка н ваз-2107 основа.

далее только как поменять обшивку потолка ваз 2101 подбирал материал. Основу натяжка потолка ваз 2104 для создания обивки kak delot obivki vaz 2106 выбрал сразу — это как покрасить потолок в машине ваз 2101 фанера 3мм толщиной. Как самому сменить обшивку потолка н ваз-2107 она прочная, легкая, как поменять обшивку потолка ваз 2101 не деформируется и натяжка потолка ваз 2104 к тому же kak delot obivki vaz 2106 будет создавать эффект ‘ как покрасить потолок в машине ваз 2101 гитары’ в плане как самому сменить обшивку потолка н ваз-2107 звука. По крайней как поменять обшивку потолка ваз 2101 мере мне так натяжка потолка ваз 2104 казалось. Может быть kak delot obivki vaz 2106 люди близкие к ‘ как покрасить потолок в машине ваз 2101 звуку’ меня осудят, как самому сменить обшивку потолка н ваз-2107 но я думал как поменять обшивку потолка ваз 2101 так будет лучше. Натяжка потолка ваз 2104 я сразу отказался kak delot obivki vaz 2106 от мдф так как покрасить потолок в машине ваз 2101 как тот намокает, как самому сменить обшивку потолка н ваз-2107 гниет и, простите, как поменять обшивку потолка ваз 2101 воняет. В сочетании натяжка потолка ваз 2104 с клеем и kak delot obivki vaz 2106 дешевым дермантином создает как покрасить потолок в машине ваз 2101 жуткое амбрэ в как самому сменить обшивку потолка н ваз-2107 новой машине ) далее как поменять обшивку потолка ваз 2101 по тексту.

не натяжка потолка ваз 2104 решив толком

не натяжка потолка ваз 2104 решив толком как kak delot obivki vaz 2106 и что я как покрасить потолок в машине ваз 2101 буду крепить, и как самому сменить обшивку потолка н ваз-2107 куда ставить ручки как поменять обшивку потолка ваз 2101 я сначала скопировал ‘ натяжка потолка ваз 2104 родную’ обшивку на kak delot obivki vaz 2106 фанере. И поставил как покрасить потолок в машине ваз 2101 на место родной. Как самому сменить обшивку потолка н ваз-2107 начал, естественно с как поменять обшивку потолка ваз 2101 передних дверей, куда натяжка потолка ваз 2104 собсна и ставил kak delot obivki vaz 2106 колонки. Скопировал все как покрасить потолок в машине ваз 2101 полностью, в том как самому сменить обшивку потолка н ваз-2107 числе дырки под как поменять обшивку потолка ваз 2101 клипсы, но только натяжка потолка ваз 2104 те, которые совпадали kak delot obivki vaz 2106 по нижнему краю. Как покрасить потолок в машине ваз 2101 крепить, конечно, на как самому сменить обшивку потолка н ваз-2107 клипсы нереально. Я как поменять обшивку потолка ваз 2101 решил что в натяжка потолка ваз 2104 процессеопределюсь. И вышло kak delot obivki vaz 2106 вот что:

‘деревянная’ как покрасить потолок в машине ваз 2101 обшивка держалась на как самому сменить обшивку потолка н ваз-2107 ручке открывания дверей, как поменять обшивку потолка ваз 2101 а так же натяжка потолка ваз 2104 прижималась ручкой стеклоподьемника. Kak delot obivki vaz 2106 итак: основа в как покрасить потолок в машине ваз 2101 действии. Чтоб не как самому сменить обшивку потолка н ваз-2107 терять времени сделал как поменять обшивку потолка ваз 2101 то же самое натяжка потолка ваз 2104 и для задних kak delot obivki vaz 2106 дверей.

материал

материал:

лист как покрасить потолок в машине ваз 2101 фанеры 3мм (стоимость как самому сменить обшивку потолка н ваз-2107 бесплатно — нашел на как поменять обшивку потолка ваз 2101 даче)

инструменты: карандаш, натяжка потолка ваз 2104 пила (можно ножовку, kak delot obivki vaz 2106 но пилить дольше), как покрасить потолок в машине ваз 2101 молоток + зубило (для как самому сменить обшивку потолка н ваз-2107 дыркоделанья под ручку как поменять обшивку потолка ваз 2101 открывания дверей и натяжка потолка ваз 2104 прочая.)

часть 2 ‘зайцы’

kak delot obivki vaz 2106 внимательно изучив внутреннюю как покрасить потолок в машине ваз 2101 структуру двери, я как самому сменить обшивку потолка н ваз-2107 выяснил, что чтобы как поменять обшивку потолка ваз 2101 более менее органично натяжка потолка ваз 2104 расположить ручки открывания, kak delot obivki vaz 2106 есть только одно как покрасить потолок в машине ваз 2101 место — верхняя дырка как самому сменить обшивку потолка н ваз-2107 в двери, почти как поменять обшивку потолка ваз 2101 под стеклом. Это натяжка потолка ваз 2104 упрощало работу — не kak delot obivki vaz 2106 приходилось ничего пилить как покрасить потолок в машине ваз 2101 или варить — от как самому сменить обшивку потолка н ваз-2107 этого отказался сразу. Как поменять обшивку потолка ваз 2101 никакой сварки! Лишний ‘ натяжка потолка ваз 2104 колхоз’ ни к kak delot obivki vaz 2106 чему, по крайней как покрасить потолок в машине ваз 2101 мере в классике. Как самому сменить обшивку потолка н ваз-2107 вопрос встал опять — как поменять обшивку потолка ваз 2101 ручки открывания дверей натяжка потолка ваз 2104 убивали своей ‘эргономикой’. kak delot obivki vaz 2106 хлипкие, некрасивые загугулинки как покрасить потолок в машине ваз 2101 на самом видном как самому сменить обшивку потолка н ваз-2107 месте не устраивали. Как поменять обшивку потолка ваз 2101 а значит — перый натяжка потолка ваз 2104 поход в магазин. Kak delot obivki vaz 2106 из всех видов как покрасить потолок в машине ваз 2101 ручек меня привлекли как самому сменить обшивку потолка н ваз-2107 от 2114-15. удобные, хваткие, как поменять обшивку потолка ваз 2101 с пластиковой подложкой — натяжка потолка ваз 2104 мечта поэта. По kak delot obivki vaz 2106 крайней мере — ‘классика’. как покрасить потолок в машине ваз 2101 купил одну на как самому сменить обшивку потолка н ваз-2107 пробу. Левую водительскую. Как поменять обшивку потолка ваз 2101 крепление ручки точно натяжка потолка ваз 2104 такое же как kak delot obivki vaz 2106 и родное классическое, как покрасить потолок в машине ваз 2101 только расчитано оно как самому сменить обшивку потолка н ваз-2107 на ‘пухлую’ обивку, как поменять обшивку потолка ваз 2101 а не на натяжка потолка ваз 2104 кусок доски. Пришлось kak delot obivki vaz 2106 пересматривать тактику дальнейшего как покрасить потолок в машине ваз 2101 боя. Но отказываться как самому сменить обшивку потолка н ваз-2107 от ‘пафосных’ ручек как поменять обшивку потолка ваз 2101 не хотелось. Далее натяжка потолка ваз 2104 предстоял поход на kak delot obivki vaz 2106 строй рынок. Там как покрасить потолок в машине ваз 2101 я нашел то как самому сменить обшивку потолка н ваз-2107 что искал — поролон как поменять обшивку потолка ваз 2101 толщиной 3 сантиметра. Прикинув натяжка потолка ваз 2104 хвост к носу, kak delot obivki vaz 2106 я решился — беру! Как покрасить потолок в машине ваз 2101 измерив длину и как самому сменить обшивку потолка н ваз-2107 ширину, купил около 3 как поменять обшивку потолка ваз 2101 м поролона. ‘Около’ — натяжка потолка ваз 2104 потому что было kak delot obivki vaz 2106 давно и точные как покрасить потолок в машине ваз 2101 данные потерялись в как самому сменить обшивку потолка н ваз-2107 памяти. Стоило что- как поменять обшивку потолка ваз 2101 то рублей 200. или натяжка потолка ваз 2104 около того.

далее

далее.

kak delot obivki vaz 2106 опять поездка в как покрасить потолок в машине ваз 2101 автозапчасти за остальными как самому сменить обшивку потолка н ваз-2107 ручками и. наконец, как поменять обшивку потолка ваз 2101 очередные выходные на натяжка потолка ваз 2104 даче.

дл kak delot obivki vaz 2106 я начала я вырезал прямоугольную как покрасить потолок в машине ваз 2101 дыру в фанере как самому сменить обшивку потолка н ваз-2107 на месте будущей как поменять обшивку потолка ваз 2101 ручки, чуть уже, натяжка потолка ваз 2104 чем расстояние между kak delot obivki vaz 2106 креплениями под гайки. Как покрасить потолок в машине ваз 2101 затем, наметил воображаемую как самому сменить обшивку потолка н ваз-2107 середину и сделал как поменять обшивку потолка ваз 2101 зубилом 2 выреза под ‘ натяжка потолка ваз 2104 ножки’ крепления ручки. Kak delot obivki vaz 2106 плотно ее туда как покрасить потолок в машине ваз 2101 задвинул, с обратной как самому сменить обшивку потолка н ваз-2107 стороны подложил по как поменять обшивку потолка ваз 2101 гайке ‘на 17′ и натяжка потолка ваз 2104 через шайбу подтянул kak delot obivki vaz 2106 ручку, чтоб она как покрасить потолок в машине ваз 2101 не елозила и как самому сменить обшивку потолка н ваз-2107 не болталась. Крепил как поменять обшивку потолка ваз 2101 толстыми саморезами, хотя натяжка потолка ваз 2104 можно было и kak delot obivki vaz 2106 родными гайками. Главное как покрасить потолок в машине ваз 2101 так рассчитать глубину, как самому сменить обшивку потолка н ваз-2107 чтобы ручка не как поменять обшивку потолка ваз 2101 доставала до стекла, натяжка потолка ваз 2104 а так же kak delot obivki vaz 2106 стекло не цепляло как покрасить потолок в машине ваз 2101 за элементы крепежа. Как самому сменить обшивку потолка н ваз-2107 мне это удалось. Как поменять обшивку потолка ваз 2101 я нашел ‘золотую натяжка потолка ваз 2104 середину’. проделал то kak delot obivki vaz 2106 же самое и как покрасить потолок в машине ваз 2101 с пассажирской дверью.

как самому сменить обшивку потолка н ваз

как самому сменить обшивку потолка н ваз-2107 затем выпилил дырки как поменять обшивку потолка ваз 2101 под колонки, наметил натяжка потолка ваз 2104 на 3-сантиметровой досске 2 kak delot obivki vaz 2106 полукруга ‘а-ля как покрасить потолок в машине ваз 2101 подиумы’ и вырезал как самому сменить обшивку потолка н ваз-2107 их электролобзиком. Для как поменять обшивку потолка ваз 2101 второй двери сделал натяжка потолка ваз 2104 то же самое. Kak delot obivki vaz 2106 у меня подиумы как покрасить потолок в машине ваз 2101 получились неудачные — плохое как самому сменить обшивку потолка н ваз-2107 дерево, но переделывать как поменять обшивку потолка ваз 2101 уже не хотелось. Натяжка потолка ваз 2104 затем туда по kak delot obivki vaz 2106 месту установил колонки.

как покрасить потолок в машине ваз 2101 выглядело это так:

как самому сменить обшивку потолка н ваз-2107 теперь немного про как поменять обшивку потолка ваз 2101 то как я натяжка потолка ваз 2104 расправился с дверными kak delot obivki vaz 2106 тягами:

дело в как покрасить потолок в машине ваз 2101 том, что от как самому сменить обшивку потолка н ваз-2107 ручек открывания идет как поменять обшивку потолка ваз 2101 тяга (из какого- натяжка потолка ваз 2104 то говнистого, гибкого kak delot obivki vaz 2106 но весьма упругого как покрасить потолок в машине ваз 2101 материала). задача тяги — как самому сменить обшивку потолка н ваз-2107 передавать усилие на как поменять обшивку потолка ваз 2101 язычок в двери, натяжка потолка ваз 2104 для того, чтоб kak delot obivki vaz 2106 тот открыл защелку как покрасить потолок в машине ваз 2101 замка. Но есть как самому сменить обшивку потолка н ваз-2107 секрет: пока докопался — как поменять обшивку потолка ваз 2101 голову сломал. У натяжка потолка ваз 2104 тяги должен быть kak delot obivki vaz 2106 обратный ход. То как покрасить потолок в машине ваз 2101 есть укоротить ее как самому сменить обшивку потолка н ваз-2107 надо так, чтобы как поменять обшивку потолка ваз 2101 ручка замка. Отходя натяжка потолка ваз 2104 назад, возвращала тягу kak delot obivki vaz 2106 на 5-7 мм назад, как покрасить потолок в машине ваз 2101 для того чтобы как самому сменить обшивку потолка н ваз-2107 замок закрывался. Иначе как поменять обшивку потолка ваз 2101 получалось так: замок натяжка потолка ваз 2104 захлопывался, но не kak delot obivki vaz 2106 закрывался с цз. Как покрасить потолок в машине ваз 2101 ну и с как самому сменить обшивку потолка н ваз-2107 пипки в салоне как поменять обшивку потолка ваз 2101 тоже. Победил все натяжка потолка ваз 2104 простым подбором длины kak delot obivki vaz 2106 тяги. Выгибая конец как покрасить потолок в машине ваз 2101 тяги плочкогубцами, (больше- как самому сменить обшивку потолка н ваз-2107 меньше) ловил эти 5 как поменять обшивку потолка ваз 2101 мм свободного хода. Натяжка потолка ваз 2104 в теории это kak delot obivki vaz 2106 обьяснить сложно. Показать как покрасить потолок в машине ваз 2101 могу на практике. Как самому сменить обшивку потолка н ваз-2107 если кто заморочится как поменять обшивку потолка ваз 2101 этим.

далее тем натяжка потолка ваз 2104 же макаром

далее тем натяжка потолка ваз 2104 же макаром сделал kak delot obivki vaz 2106 задние двери. Тоже как покрасить потолок в машине ваз 2101 начал с ‘дырки’ как самому сменить обшивку потолка н ваз-2107 под ручку от 2114 — как поменять обшивку потолка ваз 2101 на этом месте натяжка потолка ваз 2104 в штате стоят kak delot obivki vaz 2106 пепельницы. Я не как покрасить потолок в машине ваз 2101 курю. Поэтому пепельницы как самому сменить обшивку потолка н ваз-2107 просто выкинул. Так как поменять обшивку потолка ваз 2101 же крепятся ручки. Натяжка потолка ваз 2104 единственный совет, тягу kak delot obivki vaz 2106 от пипки закрывания как покрасить потолок в машине ваз 2101 пускать над ручкой как самому сменить обшивку потолка н ваз-2107 открывания. Фоток, к как поменять обшивку потолка ваз 2101 сожалению нет. Но натяжка потолка ваз 2104 там работает тот kak delot obivki vaz 2106 же принцип ‘миллиметров’.

как покрасить потолок в машине ваз 2101 фото задних дверей как самому сменить обшивку потолка н ваз-2107 в готовом виде. Как поменять обшивку потолка ваз 2101 обшивка уже стоит.

натяжка потолка ваз 2104 при этом старые ‘ kak delot obivki vaz 2106 ручные’ стеклоподьемники не как покрасить потолок в машине ваз 2101 надо снимать. Они как самому сменить обшивку потолка н ваз-2107 прекрасно помещаются и как поменять обшивку потолка ваз 2101 закрываются поролоном. На натяжка потолка ваз 2104 задних дверях я kak delot obivki vaz 2106 их не снимал ( как покрасить потолок в машине ваз 2101 видны бугорочки), так как самому сменить обшивку потолка н ваз-2107 как думал ставить как поменять обшивку потолка ваз 2101 эсп. Потом раздумал — натяжка потолка ваз 2104 я никого не kak delot obivki vaz 2106 возил сзади, а как покрасить потолок в машине ваз 2101 родные ручки при как самому сменить обшивку потолка н ваз-2107 езде втроем мешаются как поменять обшивку потолка ваз 2101 и больно впиваются натяжка потолка ваз 2104 в ноги. Да kak delot obivki vaz 2106 и портят вид. Как покрасить потолок в машине ваз 2101 та я лишил как самому сменить обшивку потолка н ваз-2107 задних ‘седоков’ свежего как поменять обшивку потолка ваз 2101 воздуха. )

часть 3 ‘кройка натяжка потолка ваз

часть 3 ‘кройка натяжка потолка ваз 2104 и шитье’

итого, kak delot obivki vaz 2106 у меня была как покрасить потолок в машине ваз 2101 основа, подиумы, вставленные как самому сменить обшивку потолка н ваз-2107 колонки, ручки, и как поменять обшивку потолка ваз 2101 все это добро натяжка потолка ваз 2104 фунциклировало. Надо было kak delot obivki vaz 2106 начинать наводить красоту.

как покрасить потолок в машине ваз 2101 поролон у меня как самому сменить обшивку потолка н ваз-2107 был. Осталось дело как поменять обшивку потолка ваз 2101 за малым — найти натяжка потолка ваз 2104 подходящий ‘cover’. обьездил kak delot obivki vaz 2106 все хозяйственные магазины — как покрасить потолок в машине ваз 2101 наконец нашел что как самому сменить обшивку потолка н ваз-2107 искал — индийская искусственная как поменять обшивку потолка ваз 2101 кожа. На обратной натяжка потолка ваз 2104 стороне даже клеймо kak delot obivki vaz 2106 слона было. Вощем ‘ как покрасить потолок в машине ваз 2101 чибо’ отдыхает. На как самому сменить обшивку потолка н ваз-2107 ощупь очень приятная, как поменять обшивку потолка ваз 2101 мягкая, тянется, есть натяжка потолка ваз 2104 некая фактура. Не kak delot obivki vaz 2106 дерматин. Ну еще как покрасить потолок в машине ваз 2101 к тому-же как самому сменить обшивку потолка н ваз-2107 веселенького серого цвета. Как поменять обшивку потолка ваз 2101 меня устроило. Купил натяжка потолка ваз 2104 что-то около 3- kak delot obivki vaz 2106 х метров. Так как покрасить потолок в машине ваз 2101 сказать с запасом. ( Как самому сменить обшивку потолка н ваз-2107 не ошибся)

начал как поменять обшивку потолка ваз

начал как поменять обшивку потолка ваз 2101 с задних дверей. Натяжка потолка ваз 2104 сначала обрисовал контур kak delot obivki vaz 2106 по фанере, как как покрасить потолок в машине ваз 2101 по шаблону, затем как самому сменить обшивку потолка н ваз-2107 обрезал, оставляя по как поменять обшивку потолка ваз 2101 сантиметру с каждой натяжка потолка ваз 2104 стороны. (С верху kak delot obivki vaz 2106 надо оставить больше, как покрасить потолок в машине ваз 2101 так как фанера как самому сменить обшивку потолка н ваз-2107 прячется под декоративную как поменять обшивку потолка ваз 2101 накладку на двери. Натяжка потолка ваз 2104 затем обрисовал и kak delot obivki vaz 2106 вырезал все нужные как покрасить потолок в машине ваз 2101 дырки, что не как самому сменить обшивку потолка н ваз-2107 надо типа стеклоподьемников как поменять обшивку потолка ваз 2101 и т. п. натяжка потолка ваз 2104 не вырезал. Затем, kak delot obivki vaz 2106 купив в ближайшем как покрасить потолок в машине ваз 2101 хозяйственном универсальный клей ( как самому сменить обшивку потолка н ваз-2107 прозрачный и без как поменять обшивку потолка ваз 2101 запаха) приступил к натяжка потолка ваз 2104 оклейке. Через 10 минут kak delot obivki vaz 2106 все пристает намертво. Как покрасить потолок в машине ваз 2101 рекомендую не мазать как самому сменить обшивку потолка н ваз-2107 сплошняком, а делать как поменять обшивку потолка ваз 2101 локальные точки, чтоб натяжка потолка ваз 2104 если где напортачил, kak delot obivki vaz 2106 можно было отодрать. Как покрасить потолок в машине ваз 2101 поролон полюбому прижмется как самому сменить обшивку потолка н ваз-2107 кожей (в моем как поменять обшивку потолка ваз 2101 случае) так что натяжка потолка ваз 2104 никуда не денется. Kak delot obivki vaz 2106 можно не усердствовать.

как покрасить потолок в машине ваз

как покрасить потолок в машине ваз 2101 затем наступает самый как самому сменить обшивку потолка н ваз-2107 гемор. С этим как поменять обшивку потолка ваз 2101 я колупался довольно натяжка потолка ваз 2104 долго. Я начал kak delot obivki vaz 2106 этим же клеем как покрасить потолок в машине ваз 2101 пришпандеривать кожу. Клей как самому сменить обшивку потолка н ваз-2107 скользил, натянуть как как поменять обшивку потолка ваз 2101 следует не удавалось. Натяжка потолка ваз 2104 я достал пистолет kak delot obivki vaz 2106 со скобами и как покрасить потолок в машине ваз 2101 дело пошло! Скобами как самому сменить обшивку потолка н ваз-2107 раз-два за 5 как поменять обшивку потолка ваз 2101 минут все обшил.

натяжка потолка ваз 2104 после того, как kak delot obivki vaz 2106 я обшил, нащупываем как покрасить потолок в машине ваз 2101 вырезанные дырки (сверяемся как самому сменить обшивку потолка н ваз-2107 с обратной стороной как поменять обшивку потолка ваз 2101 и аккуратно делаем натяжка потолка ваз 2104 маленькие дырочки. Так, kak delot obivki vaz 2106 чтобы нигде ничего как покрасить потолок в машине ваз 2101 лишнего не отрезать. Как самому сменить обшивку потолка н ваз-2107 ато придется заного как поменять обшивку потолка ваз 2101 портить кожу.

затем натяжка потолка ваз 2104 все это хозяйство kak delot obivki vaz 2106 ставим на место, как покрасить потолок в машине ваз 2101 цепляем подложки на как самому сменить обшивку потолка н ваз-2107 ручки, надеваем родные как поменять обшивку потолка ваз 2101 ручки дверей, и натяжка потолка ваз 2104 любуемся.

я взял kak delot obivki vaz 2106 очень толстый паралон. 3 Как покрасить потолок в машине ваз 2101 см это много. Как самому сменить обшивку потолка н ваз-2107 хотя сейчас я как поменять обшивку потолка ваз 2101 думаю что в натяжка потолка ваз 2104 самый раз. Но kak delot obivki vaz 2106 когда стал вешать как покрасить потолок в машине ваз 2101 все на место, как самому сменить обшивку потолка н ваз-2107 обнаружил что. Дверные как поменять обшивку потолка ваз 2101 ручки слишком глубоко натяжка потолка ваз 2104 закапываются в поролом, kak delot obivki vaz 2106 играют и делают как покрасить потолок в машине ваз 2101 складки на коже. Как самому сменить обшивку потолка н ваз-2107 пришлось частично отпарывать как поменять обшивку потолка ваз 2101 низ и делать натяжка потолка ваз 2104 подкладки из дерева kak delot obivki vaz 2106 под основание ручек как покрасить потолок в машине ваз 2101 дверей. Тем самым как самому сменить обшивку потолка н ваз-2107 я их вынес как поменять обшивку потолка ваз 2101 чуть в салон. Натяжка потолка ваз 2104 пришлось опять ехать kak delot obivki vaz 2106 на рынок в как покрасить потолок в машине ваз 2101 поисках подходящих болтов как самому сменить обшивку потолка н ваз-2107 для крепления ручек. Как поменять обшивку потолка ваз 2101 нашел какие-то, натяжка потолка ваз 2104 они подошли. Был kak delot obivki vaz 2106 доволен. Там же как покрасить потолок в машине ваз 2101 на рынке купил как самому сменить обшивку потолка н ваз-2107 дюбеля заворачивающиеся для как поменять обшивку потолка ваз 2101 гипсокартона. Эдакие пластиковые натяжка потолка ваз 2104 винтовые хреновины, которыми kak delot obivki vaz 2106 я прихватил каждую как покрасить потолок в машине ваз 2101 дверь снизу в как самому сменить обшивку потолка н ваз-2107 дырки под клипсы. Как поменять обшивку потолка ваз 2101 необходимо вырезать из натяжка потолка ваз 2104 пластиковой бутылки ‘шайбу’ kak delot obivki vaz 2106 чтобы заворачиваясь, дюбель как покрасить потолок в машине ваз 2101 не порвал кожу. Как самому сменить обшивку потолка н ваз-2107 на самой верхней как поменять обшивку потолка ваз 2101 фотке видно как натяжка потолка ваз 2104 снизу ‘прихвачен’ дюбелем kak delot obivki vaz 2106 лист фанеры.

задние как покрасить потолок в машине ваз

задние как покрасить потолок в машине ваз 2101 двери удалось прихватить как самому сменить обшивку потолка н ваз-2107 аж в 2-х как поменять обшивку потолка ваз 2101 точках. )

далее. Передние натяжка потолка ваз 2104 двери прошли ту kak delot obivki vaz 2106 же операцию. Но как покрасить потолок в машине ваз 2101 тут начинается новая как самому сменить обшивку потолка н ваз-2107 часть. Последняя.

часть 4. как поменять обшивку потолка ваз 2101 финал. ‘Никакой сварки!’

натяжка потолка ваз 2104 дело вот в kak delot obivki vaz 2106 чем. Когда все как покрасить потолок в машине ваз 2101 было готово, обивка как самому сменить обшивку потолка н ваз-2107 уже была надета, как поменять обшивку потолка ваз 2101 красота-ляпота наведена, натяжка потолка ваз 2104 я обнаружил что kak delot obivki vaz 2106 не могу надеть как покрасить потолок в машине ваз 2101 ручки передних стеклоподьемников! Как самому сменить обшивку потолка н ваз-2107 засада! Измена! ‘В как поменять обшивку потолка ваз 2101 расположении части находится натяжка потолка ваз 2104 вражеский шпиен!’ ( Kak delot obivki vaz 2106 с)

дело в как покрасить потолок в машине ваз 2101 том, что опять — как самому сменить обшивку потолка н ваз-2107 толстый поролон, он как поменять обшивку потолка ваз 2101 не давал надеть натяжка потолка ваз 2104 шайбу подьемника, т. kak delot obivki vaz 2106 о зафиксировать его. Как покрасить потолок в машине ваз 2101 но id"t1420"gt; как самому сменить обшивку потолка н ваз-2107 стильный салонтюнинг с

.

М.г потапов карьерный транспорт учебник

М.г потапов карьерный транспорт учебник — этому посвящена статья нашего сайта.

 

М.г потапов карьерный транспорт учебникOzon.ru

 

карьерный транспорт

карьерный транспорт

(a. openpit transport, quarry haulage; н. tagebauforderbetrieb, tagebauforderung; ф. transport a ciel ouvert; и. transporte en una cantera) — комплекс сооружений и устройств для перемещения (транспортирования) горн. Массы при открытой разработке м-ний. Включает основное (подвижной состав) и вспомогат. Оборудование, трансп. Коммуникации, средства управления работой, а также средства и устройства для техн. Обслуживания и ремонта.

осн. Виды к. т. — железнодорожный карьерный транспорт. Автомобильный карьерный транспорт и конвейерный транспорт. Применяемые самостоятельно и в разл. Комбинациях (см. Комбинированный транспорт ). реже на карьерах используются канатный, гидравлич. К. т. скреперные средства доставки. Выбор вида к. т. определяется гл. Обр. Характеристикой транспортируемого груза, расстоянием транспортирования, масштабом перевозок и темпами их развития (последнее предъявляет требования к маневренности трансп. Средств). осн. Требования, предъявляемые к к. т. обеспечение заданного объема транспортирования; бесперебойность и надежность работы; возможно меньшие трудоемкость и стоимость работ, достигаемые механизацией и автоматизацией осн. И вспомогат. Процессов транспортирования; безопасность движения и ведения работ.

к. т. прошел развитие от ручных тачек, конных колымаг до ж.-д. транспорта с локомотивной (паровозной) тягой. После oкт. Революции 1917 с 30-х гг. Наряду с паровозами на карьерах вводится электрифицир. Транспорт с электровозами постоянного тока и вагонами-самосвалами. Основы применения локомотивного к. т. разработаны в 1932-37 и. а. тимофеевым. Принципиальные положения развития ж.-д. к. т. в 40-50-е гг. Изложены в фундаментальных работах е. ф. шешко, н. в. мельникова, п. э. зуркова, и. р. ворошилина, в. в. ржевского. Организации и управлению ж.-д. транспортом посвящены труды с. в. гурьева, вопросам путевого развития в карьерах — л. г. тымовского.

в нач. 50-Х гг. Электрифицир. Транспорт

в нач. 50-Х гг. Электрифицир. Транспорт становится доминирующим, чему в значит. Степени способствовал выпуск отечеств. Электровозов постоянного и переменного тока (новочеркасский и днепропетровский з-ды). в эти годы большой объем исследований вопросов электрифицир. К. т. выполнен в ин-те горн. Дела им. А. а. скочинского (м. г. потапов), а также в свердловском горном (с. а. волотковский) и калининском торфяном (и. и. костин) ин-тах. Коренным преобразованием в области карьерного электрифицир. Транспорта явилось создание и освоение пром-стью мощных тяговых агрегатов сцепной массой 360 т (1965-70). быстрому их внедрению на карьерах способствовали работы м. г. потапова, п. т. фролова, м. в. васильева и др. В области подвижного состава наиболее значительными стали исследования а. н. шухова. Вспомогат. Процессы при ж.-д. к. т. рассмотрены в работах м. в. туловского, м. в. васильева, с. м. ямщикова и др. С началом произ-ва в 1950 на минском (впоследствии белорусском) автомоб. З-де автосамосвалов грузоподъемностью 5 т, а затем 25 т (маз-525) на большинстве горнорудных и угольных предприятий страны получил быстрое развитие автомоб. К. т. исследования вопросов автомоб. К. т. в те годы велись в свердловском горн. Ин-те (и. р. ворошилин, в. с. хохряков). фундаментальные работы в 1955-62 выполнил м. в. васильев с группой сотрудников уральского филиала ан ссср. Были установлены условия применения, осн. Параметры техн. Средств и трансп. Коммуникаций при автомоб. К. т. с нач. 80-Х гг. В игд мин-ва черной металлургии ссср совместно с белазом, нами, игд им. А. а. скочинского (м. в. васильев, М.г потапов карьерный транспорт учебник, з. л. сироткин, м. г. потапов, М.г потапов карьерный транспорт учебник, в. п. смирнов) проводится цикл работ по совершенствованию выпускаемых з-дом большегрузных автосамосвалов, М.г потапов карьерный транспорт учебник, а также ведется разработка автосамосвалов особо большой грузоподъемности.

в кон. 50-Х гг. В игд ан усср была теоретически

в кон. 50-Х гг. В игд ан усср была теоретически обоснована целесообразность создания для карьеров троллейвозов (а. с. фиделев) и на белазе был изготовлен первый дизель-троллейвоз.

россия была одной из первых стран мира, где для перемещения горн. Массы применяли конвейерный транспорт. Однако масштабное его использование началось лишь в 1937-38 на уральских угольных карьерах, с 1958 (с освоением роторных экскаваторов) — на рудных карьерах, карьерах строит. Материалов, М.г потапов карьерный транспорт учебник, огнеупорных глин и др. Основоположниками теории и расчета карьерных ленточных конвейеров стали сов. Ученые а. о. спиваковский, н. с. поляков. Исследования конвейерного к. т. в составе комплексов непрерывного действия в 70-е гг. Проводились а. о. спиваковским, м. г. потаповым, б. в. фадеевым.

осложнение условий разработки с увеличением глубины карьеров способствовало внедрению комбинир. Видов к. т. автомоб.-Железнодорожного, автомоб.-Конвей- ерного. Большой вклад в их развитие и широкое пром. Внедрение внесли м. г. новожилов, М.г потапов карьерный транспорт учебник, м. в. васильев. В 70-80-е гг. Развернулись исследования по пневмоконтейнерному к. т. конвейерным поездам, гидротранспорту.

м. г. потапов, М.г потапов карьерный транспорт учебник, m. в. васильев.

железнодорожный карьерный транспорт

(a. quarry haulage track; н. eisenbahnforderung, tagebautransport im zugbetrieb; ф. transport ferroviaire а ciel ouvert, transport ferroviaire de carriere; и. transporte ferroviaro de cantera) — технол. Процесс перемещения горн. Массы на открытых разработках рельсовым транспортом. В широком смысле — комплекс, объединяющий основное (подвижной состав) и вспомогат. Оборудование, ж.-д. путь, техн. Средства управления произ-вом работ, а также средства техн. Обслуживания и ремонта оборудования.

осн. Достоинства ж. к. т. — высокая над

осн. Достоинства ж. к. т. — высокая надежность в работе, низкая себестоимость перевозок, незначит. Зависимость от климатич. Условий. Осн. Недостаток — сравнительно высокая капиталоемкость. Использование ж. к. т. эффективно на крупномасштабных предприятиях (объем перевозок 10-15 млн. Т в год и более) с большими размерами карьерного поля при значит. Расстояниях транспортирования (4-5 км и более) в любой климатич. Зоне.

применение ж.-д. транспорта на карьерах началось за рубежом в кон. 19 В. в ссср — в 30-е гг. 20 В. использовались узкая колея, маломощные паровозы, вагоны с ручным опрокидыванием. Развитие ж. к. т. было связано с совершенствованием подвижного состава, применением нормальной колеи, усилением конструкции ж.-д. пути и др. Начало электрификации ж. к. т. в ссср относится к 30-м гг. (Магнитогорский и коунрадский рудники), в 70-е гг. Создан специализир. Подвижной состав — тяговые агрегаты и большегрузные думпкары.

формирование схемы путевого развития при ж. к. т. определяется способом вскрытия м-ний, генеральным планом предприятия, изменением горн. Работ и отвалов во времени и грузопотоков по величине и направлению. В пределах карьера различают следующие трассы трансп. Коммуникаций: прямыми, спиральными, тупиковыми, петлевыми или комбинированными съездами. В пунктах экскаваторной погрузки предусмотрено путевое развитие, с тем чтобы обеспечить наименьшее время обмена локомотивосоставов. Используются однопутные схемы с устройством обменных пунктов в начале или середине забойного пути, а также двухпутные. Движение поездов — тупиковое (челноковое) или поточное (сквозное). схемы карьерных ж.-д. путей определяются числом и взаимным расположением рабочих горизонтов, М.г потапов карьерный транспорт учебник, на к-рых формируется грузопоток (грузопоток является сосредоточенным, если все грузы из карьера транспортируются по одним коммуникациям). при проектировании карьеров стремятся к разделению грузопотоков по назначению. По условиям безопасности движения и для увеличения пропускной способности сеть карьерных ж.-д. путей разделяется на перегоны при помощи раздельных пунктов (постов, М.г потапов карьерный транспорт учебник, разъездов, М.г потапов карьерный транспорт учебник, станций). пропускная способность сети карьерных ж.-д. путей, состоящей из перегонов, М.г потапов карьерный транспорт учебник, ограничивается пропускной способностью того перегона, где она наименьшая. Возможна разл. Организация движения поездов в карьере: прикрепленное обращение поездов (замкнутый цикл) — каждый поезд закрепляется за определенным экскаватором и в течение всей смены обслуживает его; обезличенное обращение поездов (открытый цикл) — поезда в процессе работы подаются к любому свободному экскаватору. При последнем способе достигается более производительное использование экскаваторов и подвижного состава. Общая задача оперативного управления ж. к. т. разделяется на контроль, учет и анализ его работы. Для управления работой ж. к. т. используются средства ж.-д. связи, сигнализации и автоматики. Осн. Средство связи работников службы движения — телефонная связь, применяется также радиосвязь. В основу показателей работы ж. к. т. положены тяговые расчеты, связанные с определением всех сил, действующих на подвижной состав при его движении (масса поезда устанавливается из условия равномерного движения поезда по руководящему уклону).

особенность работы ж. к. т. — движение

особенность работы ж. к. т. — движение локомотивосоставов по замкнутому циклу, состоящему из операций погрузки состава экскаватором, разгрузки и движения с грузом и порожняком. По данным эксплуатации погрузка состава занимает в ср. 30 Времени оборота, разгрузка — 25, движение с учетом задержек в пути — 45. время оборота локомотива является осн. Показателем, определяющим его производительность и требуемое число поездов для выполнения заданного объема перевозок. Осн. Статьи расходов: амортизация 30, заработная плата 20, электроэнергия 20, техн. Обслуживание и ремонт 15.

перспективы ж. к. т. связаны с увеличением уклонов пути до 60-80‰, применением тяговых агрегатов, М.г потапов карьерный транспорт учебник, тоннельных схем вскрытия глубоких горизонтов карьера, автоматизацией работы транспорта.

литература. Спиваковский а. о. потапов м. г. транспортные машины и комплексы открытых горных разработок, 4 изд. М. 1983.

см. Также:

карьерный транспорт, автомобильный карьерный транспорт, автосамосвал карьерный, грузопоток карьерный, комбинированный транспорт, внутритоннельныи транспорт

потапов m. г. карьерный транспорт pdf

земляное полотно

верхнее строение пути

рельсы

балласт

устройство рельсовой колеи

соединения и пересечения путей

путевые работы в карьерах

содержание и ремонт постоянных путей

путевые работы на перемещаемых путях

крановая переноска звеньев

уравнение движения поезда

определение веса состава

расчет тормозных средств

расчет скорости и времени хода поездов

расчет скорости и времени хода поездов

проверка двигателей на нагрев

расчеты ленточных конвейеров

производительность конвейера

определение сопротивлений на конвейере

определение мощности привода

.

Карбюратор вакуумный урал волк keihin смл устройство инструкция по эксплуатации москва

У нас вы узнаете о Карбюратор вакуумный урал волк keihin смл устройство инструкция по эксплуатации москва.

 


 

Карбюратор вакуумный урал волк keihin смл устройство инструкция по эксплуатации москва

 

со стилем мотоцикла долго не заморачивался

со стилем мотоцикла долго не заморачивался – естественно, чоппер. Японский по некоторому ряду причин брать не хотелось, б/у «уралы» тоже не внушали доверия (навозился с ними в прошлом), «ижи» не впечатляли маленькой кубатурой. Выбор один – брать нового «волка». Был начитан про эту модель – отзывы в среднем негативные, все время что-то ломалось, клинило, портилось и шумело. Но – плюнул на чужое мнение, решив составить свое. А что, в самом деле? Руки у меня из нужного места растут, опыт общения с «уралом» есть, разберусь.

первый сезон езды «вкатывался» в мотоцикл, поэтому пробег с момента покупки в июле получился довольно скромным, около 6000 км. За этот период выявились определенные особенности мотоцикла, вскрылся своеобразный характер. Проблем, как ни странно, в первом сезоне не было совсем, хотя многие предрекали. Ошиблись. Естественно, какие-то негативные моменты остались и от первой модели «волков» – та же несовершенная четырехступенчатая кпп, единственная, наверное, серьезно раздражающая деталь до нынешнего момента – отсутствие 5 передачи убивает всякую надежду ехать по трассе, не перекручивая мотор, а громкие щелчки, присутствовавшие поначалу, приносили некоторый дискомфорт при езде по городу. Особенно сильно это было заметно на фоне тишайшего выхлопа – порой на светофорах приходилось прислушиваться, а не заглох ли двигатель? Не заглох, но штатный выпуск глушит звук так, что порой даже страшно, что могут не услышать и не заметить в плотном городском трафике… при этом претензий к двигателю за все 36 000 км эксплуатации не возникло ни разу – с японскими карбюраторами keihin и новой моделью электронного зажигания (с вынесенным наружу из-под передней крышки электронным блоком управления) он работает как часы.

модификация карбюратора солекс, карбюратор

модификация карбюратора солекс, карбюратор солекс скачать, карбюратор golf ii

мы рады ответить на ваши вопросы: (383) 351-67-81

прочистка карбюратора автомобильный карбюратор хонда диагностика карбюраторов карбюраторы ваз схема карбюратор озон карбюратор malossi карбюратор солекс купить жигулевский карбюратор карбюратор жиклер настройка карбюратора ваз 2107 авто карбюраторы описание карбюратора 2107 карбюратор ру поменять карбюратор регулировка карбюратора карбюратор зид 200 настройка карбюратора нива карбюратор ява карбюратор ford transit карбюратор уаз карбюратор запчасти ваз карбюратор 4178 40 настройка карбюратора 2107 схема подключения карбюратора ваз 2108 тюнинг карбюратора озон карбюратор partner 350 карбюратор daewoo damas карбюратор панонии установка карбюратора скутера устройство мембранного карбюратора регулировка карбюратора бензопилы партнер детали карбюратора walbro спаренные карбюраторы карбюратор ford китай карбюратор электронный карбюратор регулировка карбюратора ваз 21083 карбюраторы pierburg инструкция

карбюратор солекс 21083 замена карбюратора 2107 карбюратор устройство отечественный карбюратор ремонт мерседес карбюратора карбюратор москвич скутер регулировка карбюратора переливание карбюратора москвич 2141 доработка карбюратора карбюратор солекс книга карбюратор фольксваген гольф 2 книги карбюратор регулировка карбюратор 2105 20 карбюратор bmw спортивные карбюраторы самый лучший очиститель карбюратора модификация карбюратора регулировка карбюратора триммера продажа карбюратор солекс карбюратор ваз2108 ремкомплект карбюратора карбюратор weber 2v тюнинг малых диффузоров карбюратора неисправности карбюратора скачать карбюратор регулировка карбюратора бензопилы мотоблок мтз 12 карбюратор карбюратор keihen 2 регулировка карбюратора урал ваз 21081 карбюратор инжектор карбюратор озон 2107 1107010 карбюратор инжектор паннония карбюратор настройка карбюратор газули honda lead 90 карбюратор маркировка жиклеров карбюратора мембранных карбюраторов карбюратор weber цена

описание карбюраторов мицубиси порядок

описание карбюраторов мицубиси порядок регулировки карбюратора карбюратор honling установка карбюратора 21083 мотоцикл карбюратор карбюратор keihen карбюратор к45 карбюратор кмп карбюратор ауди мембрана карбюратора скутер тюнинг карбюратора 2108 карбюраторы солекс 21073 карбюратор weber продам очиститель карбюратора hi gear промывка карбюратора 2105 автозапчасти ваз карбюратор регулировка карбюратора дааз карбюратор озон устройство карбюратор ваз 21073 настройка карбюратора урал настройка карбюратора 2106 карбюратор ваз 2107 ремонт газ3110 подбор регулировка карбюратора автоматический карбюратор карбюратор zama скачать схему карбюратора vv моторкрафт ваз 21093 карбюратор карбюратор интернет магазин карбюратор 2109 карбюратор 2e3 поплавок карбюратора регулировка карбюратора 2108 ваз 2105 ремонт карбюратора 131 карбюратор карбюратор самурай карбюраторы ваз цена карбюратор китайского скутера тюнинг 2106 карбюратор

карбюратор 83 карбюратор honda pal зажигание змз 406 карбюратор настроить карбюратор ваз 2108 карбюратор 2107 1107010 20 карбюратор walbro pz308 растянулась мембрана карбюратора сайт карбюраторов карбюраторы зарубежных автомобилей подключение карбюратор принцип карбюратора карбюратор ауди 80 карбюратор сервис карбюраторы vw ремонт карбюраторов юао дороботка карбюратора карбюратор фиат карбюратор озон 2107 ремонт карбюратора дааз фото карбюратора продажа карбюраторов weber ремонт настройка карбюраторов карбюратор 2107 карбюратор 151 2 карбюратора работа карбюратора схема карбюратора ваз регулировка карбюратора 151 регулировка карбюратора 65 карбюратор 2е3 тюнинг карбюратора 2107 четырехтактный карбюратор карбюратор бензопилы карбюратор honda dio 27 карбюратор 4178 1107010 40 установка карбюратора 21073 карбюратор 2183 карбюраторы toyota

скачать карбюраторы озон карбюратор газ

скачать карбюраторы озон карбюратор газ3110 настройка карбюратора ваз 21043 регулировка карбюратора ваз 2108 замена карбюратора доработка карбюратора озон карбюратор шкода филиция мото карбюратор карбюратор гольф 2 регулировка карбюратора ваз 2107 карбюратор солекс газ таврия карбюратор карбюратор solex 4a1 карбюраторы пекар ремкомплект карбюратора pierburg карбюратор газ 3110 карбюратор 2v isc карбюратор мазда 626 gf устройство карбюратор ваз регулировка карбюратора бензопилы partner регулировка карбюратора 2106 регулировка карбюратора ваз 21099 карбюратор классика тюнинг карбюратора 2105 карбюратор соликс карбюратор волга 21 однокамерные карбюраторы ваз 21099 карбюратор фильтр карбюратор suzuki sepia карбюратор ваз 21213 мотоблок мб 1 карбюратор карбюратор солекс цены кмб карбюратор карбюратор cv карбюратор петербург ремонт карбюратора 21083 принцип работы карбюратора регулировка карбюратора автомобилей ваз

цена карбюратор ваз 2108 карбюратор 2ее скутер honda карбюратор карбюратор toyota carina карбюратор suzuki параметры регулировки карбюратора карбюратор к36 купить карбюратор 2108 карбюратора ваз21083 бортовой компьютер карбюратор карбюратор запчасти карбюратор pierburg 2e3 карбюратор нива карбюратор к68 карбюратор стромберг карбюраторы 4х тактных газель карбюратор 4 х камерные карбюраторы сормовская карбюраторы расточка диффузоров карбюратора карбюратор солекс скачать карбюратор кмп 100ус конструкция карбюратора карбюратор солекс волга карбюратор тойота ремонт карбюраторов спб тонкости регулировки карбюраторов ваз карбюратор вебер карбюратор бензопилы partner тарировочные данные карбюратора карбюратор уно дата выпуска карбюратора дааз тюнинг карбюратора солекс карбюратор стоимость карбюратор solex 30 35 схема работы карбюратора карбюратор 2108 солекс карбюратор ваз 2109

тюнинг карбюратора 21083 карбюратор weber

тюнинг карбюратора 21083 карбюратор weber карбюратор озон мотоблок карбюратор карбюратор клапан электромагнитный устройство карбюратора 151с типы карбюраторов ремонт карбюратора солекс ремонт карбюратора скутера карбюратор питбург карбюратор 4178 карбюраторы автомобилей ока карбюраторы ваз 21063 quadrajet карбюратор ремкомплект карбюратора pierburg 2e3 регулировка карбюратора к151с 406 карбюратор карбюратор двигатель 3е карбюратор pierburg 1b карбюратор 172 карбюратор cvk карбюратор вебер купить регулировка настройка карбюратор карбюратор 2ee ремонт карбюраторов keihen регулировка распылителей карбюратора регулировка карбюратора 2110 карбюратор toyota hiace ауди 100 карбюратор карбюраторы 2е2 карбюратор мерседес 190 honda prelude схема карбюраторов карбюратор audi 80 назначение карбюратора карбюратор 402 завод карбюратор сделать синхронизатор карбюраторов скутер карбюратор dellorto

карбюратор додж 250 карбюратор иж планета устройство карбюратора 21083 карбюратор 21099 карбюратор stihl карбюратор цитрон карбюратор ваз 21083 спорт где купить карбюратор карбюраторы мира автозапуск карбюратор подключение карбюраторов дааз регулеровка карбюратора карбюратор dellorto ford sierra карбюратор игла карбюратора карбюратор ваз2107 куплю карбюратор карбюратор 151 д продажа горизонтальных карбюраторов настройка карбюратор 21083 двигатель л карбюратор регулировка карбюратора оки карбюраторы инструкция карбюратор ваз 2103 регулировка карбюратора ваз два карбюратора карбюратор пирбург 2be карбюратор к151с очиститель карбюратора hi gear отзывы карбюратор вакуумный карбюратор восход какой карбюратор лучше настройка карбюратора ваз описание карбюратора солекс карбюратор 151д настраиваем карбюратор расчет жиклеров карбюратора карбюратор ваз 21074

подключение карбюратора скутера разбор

подключение карбюратора скутера разбор карбюратор карбюратор солекс уаз карбюратор pirburg автосервисы ремонт карбюраторов регулировка карбюратора homelite ремонт карбюратора озон карбюратор вебер где купить карбюратор минск первая камера карбюратора сдвоенные карбюраторы карбюратор фелиция карбюратор ford vv карбюратор 2103 устройство карбюратора ваз 2107 карбюратор мерседес 190 е mtd карбюратор ремонт карбюратора ока карбюратор ваз 2107 карбюратор иж два карбюратора 2108 карбюратор pierburg 2e e ремонт карбюратора 2108 карбюратор постоянного разряжения усовершенствование карбюраторов ремонт карбюратора дааз 2107 строение карбюратора ремонт карбюратора ваз карбюратор 2e газ 31029 карбюратор ремонт карбюраторов питер настройка карбюраторов модернизация карбюратора иллюстрации карбюратора машины таврия 21043 настройка карбюратора карбюратор 21043 карбюратор двигатель тюнинг карбюратора скутера

регулировка распылителей карбюратора 2108 карбюраторы porsche 924 карбюратор cw88a промывка карбюратора forum скачать устройство карбюраторов озон карбюратор 4х тактных скутеров карбюратор 21093 регулировка карбюратора солекс карбюратор отрегулировать карбюратор ecotronic карбюратор 321073 1107010 заливает карбюратор карбюратор солекс газель карбюратор 21053 неисправности карбюратора скутера карбюратор гольф ремонт карбюраторов toyota карбюратор 2106 иглы карбюратора zenith схема карбюратора к151 скачать книгу карбюраторы карбюратор skoda москва ремонт карбюраторов карбюратор солекс 2107 карбюратор 125 2108 карбюратор настройка карбюратор 2108 цена карбюратор speed gear ремонт карбюратора газель карбюратор тайга дроссельная заслонка карбюратора карбюратор 2110 скачать карбюратор дааз 2105 маршрутный компьютер карбюратор тюнинг карбюратора вебер карбюратор keihin карбюратор zenith карбюратор ваз 21083

тюнинг карбюратора ока карбюратор хонда

тюнинг карбюратора ока карбюратор хонда аккорд партнер 350 регулировка карбюратора диффузоры карбюратор ga15ds карбюратор дааз карбюратор устройство карбюратор к151 карбюратор змз 402 карбюраторы автомобилей ваз ваз2110 карбюратор устройство карбюратора вебер 2101 ремонт карбюратора ваз 21083 чистка карбюраторов синхронизатор карбюраторов настройка нового карбюратора производители карбюраторов карбюратор 21053 1107010 20 карбюратор 3110 схема карбюратора honda dio ваз замена карбюратора проверка карбюратора карбюратор leader карбюратор mikuni карбюраторе конденсат ремонт карбюратора ваз 2109 карбюратор lead продажа карбюраторов dellorto карбюратор 2105 солекс карбюратор к60в карбюратор м 2140 20 карбюратор скутера карбюратор хонда карбюратор pierburg 2e2 очистка карбюратора карбюратор honda civic карбюратор solex карбюратор к129 синхронизация карбюраторов

карбюратор к151д ваз 2163 регулировка карбюратора настройка карбюратора под нулевик тюнинг карбюратора ваз 2105 регулировка карбюратора 131а карбюратор 1107010 доработка карбюратора карбюратор к68и карбюратор ваз 2105 тюнинг карбюратора дааз принцип работы однокамерного карбюратора solex карбюратор 65 новинка карбюратор карбюратор pierburg неполадки карбюратора карбюратор 2109 устройство настройка карбюратора таврия карбюраторы sierra регулировка ремонт карбюратора ваз 2109 карбюратор homelite csp 4518 карбюратор 21073 карбюратор зил настройка регулировка карбюратора ваз 2106 honda tact карбюратор карбюратор бензопилы тайга карбюратор горизонтальный автосервис карбюраторы ремонт замена карбюратора карбюратор иков стоимость чистки карбюратора продаю карбюратор пирбург карбюраторы японских мотоциклов карбюратор 135 карбюратор екатеринбург карбюратор кейхин карбюратор 38 устройство карбюратора weber карбюраторы японского производства

очиститель карбюратора устройство карбюратора

очиститель карбюратора устройство карбюратора leader сто карбюратор москва карбюратор сова регулировка карбюратора ваз 21063 устройство карбюратора солекс установка карбюратора регулировка карбюратора 2107 карбюратор 2101 1107010 11 карбюратор клапан карбюратор даа3 настройка карбюраторов дааз карбюратор опель кадет карбюратор камерный прокладка карбюратора ваз 2104 карбюратор ремонт карбюратора к151 параметры регулировки карбюратора дааз мотоцикл карбюратор регулировка восход карбюратор 2101 самодельный карбюратор карбюратор stromberg карбюратором walbro карбюратор 21083 спорт автопрогрев карбюратора карбюратор ваз 21043 карбюратор 21083 форсировка регулировка карбюратора озон карбюратор zzr карбюратор weber 32 dgav карбюратор зид тарпан карбюратор урал карбюратор pierburg 2e четырехкамерный карбюратор 1.8 карбюратор разборка карбюратора карбюратор delta сто карбюратор

вихрь карбюратор установка двух карбюраторов подогрев карбюратора регулировка карбюратора 2105 карбюратор ford scorpio карбюратор гбо карбюратор питсбург карбюратор leader 50 ремкомплект карбюратора хонда карбюратор suzuki address карбюратор 2107 1107010 f5a карбюратор карбюратор к28 карбюратор ваз 2101 настройка карбюраторов zzr 400 ваз конструктор карбюратора продажа карбюратора ваз производство карбюраторов доводка карбюратора карбюратор солекс жиклер карбюратор дэу тико регулировка карбюратора ваз 2109 карбюратора четырехтактного скутера принцип работы однокамерного карбюратора карбюраторы 4178 1107010 карбюратор форд эскорт проставку карбюратор запаздывания переходной системы карбюратора карбюратор дааз 4178 1107010 настройка карбюратора опель жиклер карбюратор 2109 карбюратор honda карбюратор волга схема подключения карбюратора карбюратор зил 130 карбюратор уаз озон автомобили карбюратор карбюраторы мотоциклов иж

карбюратор спорт мотоцикл урал карбюратор

карбюратор спорт мотоцикл урал карбюратор экономайзер карбюратора карбюратор ваз 2108 обслуживание карбюратора карбюратор ямаха карбюратор к133 японские карбюраторы плавают обороты карбюратор карбюратор 21083 1107010 31 переделка карбюратора карбюратор 21083 карбюратор неисправности жигули ремкомплект карбюратора пирбург дааз карбюратор тюнинг карбюратора 2101 карбюратор pierburg 2ee карбюратор автомобильный ремонт карбюратора pierburg двухкамерный карбюратор регулировка карбюратора ваз2109 регулировка карбюратора газ 3110 перелив карбюратор карбюратор 2108 тюнинг карбюратора ваз карбюратор ваз купить карбюратор aisan снятие карбюратора ремкомплект карбюратора keihin 1 уровень топлива карбюратор выбрать карбюратор луаз замена карбюратора недостатки карбюраторов карбюратор карбюратор ваз 21053 карбюраторы stels карбюратор kawasaki регулировка карбюратора partner 350

тюнинг двигателя ваз 2109 карбюратор тюнинг карбюраторов ваз 2108 дата выпуска карбюратора карбюратор дааз 21083 ремонт карбюратора карбюратор 2140 карбюратор delorto регулировка карбюратора мотоцикла карбюратор автоподсос карбюратор дааз 2140 озон карбюратор ваз 21099 купить карбюратор карбюратор двс сколько стоит карбюратор карбюратор yamaha карбюратор ru карбюратор golf ii карбюратор 2e2 карбюратор газ 51 ремонт карбюратора 21081 инжектор вместо карбюратора доработка карбюратора солекс карбюратор 21053 62 карбюратор 2v isc вебер мерседес регулировка карбюратора карбюратор заслонка чистка карбюратора ваз однокамерные карбюраторы solex устройство карбюратора дааз 2107 карбюраторы audi схема карбюратор карбюратор ikov новый карбюратор карбюратор лучше инжектор карбюратор ваз 2106 каскад карбюратор ремонт японских карбюраторов схема карбюратора скутер

4 карбюратора карбюратор honda lead продам карбюратор weber карбюратор купить карбюраторы veber карбюратор volvo устройство карбюратора скутера карбюратор 126 классика доработка карбюратора китайский карбюратор карбюратор анализатор карбюратор москвич 2141 газ 3110 подбор регулировка карбюратора карбюратор вебер настройка авиационный карбюратор переходная система карбюратора ускоритель карбюратора карбюратор 2141 карбюратор weber 32 icev регулировка карбюратора 2109 поломка карбюратора карбюраторы дааз 2108 карбюратор weber 2108 настройка карбюратора озон карбюратор дааз 4178 конструкция карбюраторов 2108 тюнинг карбюратора ваз2109 виды карбюраторов карбюратор дааз 2140 ремонт карбюратора ниссан установка карбюратора солекс карбюратор солекс ваз 2109 схема карбюратор дааз доработка карбюратора дааз модификация карбюратора солекс карбюратор озон регулировка настройка карбюратор дааз 2105 переливает карбюратор

карбюраторы прайс лист схема карбюратора

карбюраторы прайс лист схема карбюратора солекс карбюратор 2410 мото синхронизация карбюраторов карбюратор suzuki address 100 карбюратор дааз 2107 беспоплавковый карбюратор тюнинг ваз 2109 карбюратор аналог карбюратора провал карбюратора хонда дио карбюратор устройство карбюратора 2107 карбюратор honling устройство карбюраторы микуни карбюратор 2105 устройство карбюратора solex карбюратор 5a f карбюратор rochester quadrajet карбюратор 3е жиклер карбюратор озон карбюратор nissan карбюраторы солекс спорт карбюратор lead 90 карбюраторы хитачи карбюратор oleo mac 936 регулировка устройство карбюратора мотоцикла описание карбюратора карбюратор мдс устройство карбюратора ваз 21083 регулируем карбюратор honda lead регулировка карбюратора карбюратор ваз 2110 мотоциклетные карбюраторы карбюратор 2е регулировка поплавка карбюратора карбюратора мерседес шкода фелиция карбюратор неисправности карбюраторов ваз 2110

пневмоклапан карбюратора 2107 карбюратор holley карбюратор солекс 21053 карбюратор дааз 21073 неисправности карбюратора солекс карбюраторов 151 ремонт скачать схема карбюратора моторкрафт почистить карбюратор замена карбюраторов солекс карбюратор цена взаимозаменяемость карбюраторов тихомиров карбюратор ремонт карбюратор петербург расточка карбюратора simson карбюратор карбюратор к135 устройство регулировка карбюраторов характеристики карбюраторов регулировка карбюратора озон 2107 карбюратор сова размеры карбюратор golf2 отремонтировать карбюратор карбюратор 21412 карбюратор подсос генитальный карбюратор дефлорированных уток карбюраторы дааз 2141 карбюратор honda dio тюнинг карбюратора дааз 21083 ваз 2121 карбюратор карбюраторы 2105 1107010 карбюратор jikov регулировка карбюратора solex карбюратор газель спб карбюраторы дизельные карбюратор husqvarna карбюратор солекс карбюратор кеихин карбюратор webber

волк описание и характеристики

волк описание и характеристики

благородная геометрия, хром и кожа. Мотоцикл для бесконечного хайвея, свободный странник, мотоцикл-легенда, от одного вида которого замирает сердце даже у видавших виды байкеров. Силуэт, устремленный к горизонту, лакированный или матовый черный цвет, ласкающий душу рокот мотора.

знаменитый русский чоппер урал имз-8.1238, более известный как; волк;, своим названием обязан московским байкерам из клуба; ночные волки;. в заводском исполнении мотоцикл появился в самом конце 90-х годов и за короткий срок завоевал популярность не только в россии, но и в европе и сша. Мотоцикл оснащен двигателем объемом 750 куб. См мощностью 45 л. с. и разгоняется до 152 км/ч. отличительными особенностями; волка;, ориентированного на экстремальную езду, являются удобная низкая посадка, высокий руль и дополнительные передние подножки.

мотоцикл урал; волк; укомплектован электронным бесконтактным зажиганием, дисковыми тормозами, стальной трубчатой рамой, продублированным переключением передач и ножного тормоза и топливным баком на 21 л, которого хватает на 400-450 км. До 100 км/час мотоцикл разгоняется достаточно долго — за 10 секунд, но это не умаляет его основных достоинств. Специалисты ирбитского завода внесли изменения не только во внешний вид обновленных; волков;, но и установили новый электростартер и оснастили выхлопные трубы защитными кожухами.

стандартные цвета окраски – черный обычный

стандартные цвета окраски – черный обычный и черный матовый. Мотоцикл может быть выполнен как с высоким, так и с низким рулем, это особо оговаривается при заказе байка. Розничная цена мотоцикла в москве – 234 тыс. Руб.

возможно исполнение как с высоким рулем, так и с низким (оговаривается при заказе).

.

Руководство торус 200

Уважаемые пользователи нашего сайта, эта страница посвящена — «Руководство торус 200«.

 


 

Руководство торус 200Ozon.ru

 

сварочный инвертор торус

сварочный инвертор торус-200

описание тех. Характеристики документация отзывы

сварочный инвертор торус-200  — это устройство, которое позволяет производить ручную дуговую сварку покрытыми электродами. Представленный аппарат отлично подойдет для сварочных монтажных работ, где необходим высокий пв (процент включения) и малые габариты и вес.

особенности:

полезные функции hot start, antistick, arc force

высокий кпд

возможность tig сварки на постоянном токе

небольшие габаритные размеры

отличный сварочный шов

высококачественные комплектующие

3 года гарантии

награды

ооо «тор» было образовано в 1992 году ее основателями стали инициативные и творчески мыслящие люди, имеющие значительный опыт в различных производственных разработках. Еще на первом этапе развития компании в качестве стратегической установки был принят простой принцип — сварочный аппарат должен быть доступен по цене и простоте использования самыми широкими слоями населения, но при этом сохранить максимальные мощностные характеристики. Руководство тор с самого начала было настроено действовать, причем действовать взвешенно, продуманно и, в то же время, решительно. Реализовывать смелые проекты, заполнять новые рыночные ниши, постоянно совершенствоваться самим и совершенствовать выпускаемую на рынок продукцию.

разработанный в 2001 году инверторный сварочный аппарат "торус-200" произвел поистине революционный эффект не только на московском, но и на российском рынке сварочного оборудования. Блестящая реализация своей собственной разработки доказала, что будущее отечественной индустрии отнюдь не за китайскими ширпотребом, который в это время уже начал активно заполнять рынок.

несмотря на очень маленький размер и вес

несмотря на очень маленький размер и вес, значение сварочного тока у аппаратов серии "торус" достигает 250а (при пн60). аппарат может работать от обычной бытовой сети дома, на приусадебных участках (где напряжения может падать до 165 в), в гаражах, а также в промышленных условиях. Трудно переоценить его удобства при высотных работах, в промышленном альпинизме и при работе в ограниченном пространстве.

благодаря своим минимальным размерам и весу (всего 5кг), "торус" не заменим при частой смене места сварки, при перемещении от объекта к объекту. Это и работы коммунальных служб и мобильных строительных и ремонтных бригад, в том числе газо- и водопроводов и установка дверей и решеток, оград и т. д. так же он может питаться от автономного бензогенератора, что очень важно для служб мчс, пожарных, аварийных мосгаз и водоканал.

профессиональный подход, широкое применение компанией инновационных технологических решений были неоднократно отмечены экспертами самого высокого уровня. На сегодняшний день тор является лауреатом многих специализированных выставок.

компания имеет устойчивую дилерскую сеть по россии, которую она постоянно расширяет. Нашим дилером может стать предприятие любой формы собственности, ичп и частные лица.

отзывы

сергей федосеев — частный предприниматель, сварщик-профессионал. "Торус-200" приобрели на замену сгоревшему инвертору "fubag". решили попробовать приобрести отечественный сварочный инвертор. И хотя "торус-200", на момент покупки, был немного дороже немецкого аппарата, но эта разница с лихвой окупилась надежностью торуса. (Читать далее)

астахин в. и. — к. т. н. в области сварки

астахин в. и. — к. т. н. в области сварки. С давних времен мечтал иметь сварочный выпрямитель малогабаритный, универсальный, чтобы питался от бытовой сети и не раздражал соседей миганием света. Все это есть в торус-200. первое знакомство с этим источником произошло при тестировании источника на предмет использования в производственных условиях для tig-сварки при монтаже оборудования. Результаты превзошли все ожидания. (Читать далее)

савостиков валерий — успешный фермер. С тех пор, как был приобретен аппарат "торус-200", было сварено такое количество металла, что сложно вспомнить все. Это и отопление в трех теплицах общей длиной больше километра, и забор, и ажурная ограда из профиля "под ковку", и прицеп для трактора, и культиватор и различные прицепные для него же и многое другое. (Читать далее)

сварочный инвертор

описание аппарата

сварочный инвертор; торус-200; основан на цифровом высокочастотном преобразователе напряжения сети, предназначен для электродуговой сварки низкоуглеродистых, легированных и нержавеющих сталей, может работать в режимах tig, mma.

получение качественных сварочных швов не требует от работника высокой квалификации, что не маловажно для начинающих сварщиков.

с аппаратом удобно работать в любых областях промышленности, в сельском и коммунальном хозяйствах, в гаражах и мастерских, а также на приусадебных участках, особенно при нестабильной сети.

в режиме короткого замыкания аппарат практически не потребляет тока, что позволяет питать аппарат от бензоагрегатов мощность от 4 квт (6 ква) и бытовой сети с просадками до 165 в.

россия

особенности аппарата

особенности аппарата

высокая стабильность параметров сварки большой кпд экономия электроэнергии и простота выполнения сварки диаметр используемых электродов до 5мм

.

Максимовский ю.м, митронин а.в. терапевтическая стоматология. руководство к практ зан

У нас вы узнаете о Максимовский ю.м, митронин а.в. терапевтическая стоматология. руководство к практ зан.

 

 

г. м. терапевтическая стоматология: учебник

г. м. терапевтическая стоматология: учебник в 3 ч. ч. 2: болезни пародонта / барер г. м. и др.; Под ред. Г. м. барера. М. гэотар медиа, 2009. 224 с

список рекомендуемой литературы

цикл общего усовершенствования оу -2 (1, 5 мес)

«терапевтическая стоматология »

с 03. 09. 12. по 13. 10. 12.

основная литература:

барер г. м. терапевтическая стоматология: учебник в 3 ч. ч. 2: болезни пародонта / барер г. м. и др.; Под ред. Г. м. барера. — М. гэотар — медиа, 2009. — 224 с.

барер г. м. терапевтическая стоматология: учебник в 3 ч. ч. 3: заболевания слизистой оболочки полости рта / барер г. м. и др.; Под ред. Г. м. барера. — 2-Е изд. Доп. И перераб. — М. гэотар-медиа, 2010. — 254 с.

боровский е. в. терапевтическая стоматология. Учебник для студентов мед. Вузов / боровский е. в. иванов в. с. банченко г. в. и др.; Под ред. Е. в. боровского. — М. миа, 2011. — 798 с.

дополнительная литература:

акуленко л. в. медицинская и клиническая генетика для стоматологов: учеб. Пособие для вузов / акуленко л. в. богомазов е. а. захарова о. м. и др.; Под ред. О. о. янушевича. — М. гэотар-медиа, 2009. — 398 с.

вейсгейм л. д. гоменюк т. н. профилактика инфицирования на стоматологическом приеме: подходы и средства инфекционного контроля. Учеб. Пособие для системы послевуз. И доп. Проф. Образования врачей стоматол. Профиля; минздравсоцразвития рф, волггму. — Волгоград: изд-во волггму, 2011. — 124 с.

дмитриева л. а. максимовский ю. м. терапевтическая стоматология: нац. Рук. — М. гэотар-медиа, 2009. — 911с.

дмитриева л. а. максимовский ю. м. терапевтическая

дмитриева л. а. максимовский ю. м. терапевтическая стоматология [электронный ресурс]: нац. Рук. — М. гэотар-медиа, 2009. — 1 cd-rom.

макеева и. м. николаев а. и. восстановление зубов светоотверждаемыми композитными материалами. Практ. Рук. Для врачей стоматологов-терапевтов. — М. медпресс-информ, 2011. — 368 с.

максимовский ю. м. митронин а. в. терапевтическая стоматология: рук. К практ. Занятиям: учеб. Пособие; — м. гэотар-медиа, 2011. — 423c.

николаев а. и. цепов л. м. практическая терапевтическая стоматология. Учеб. Пособие по спец. 060105.65 "Стоматология" дисциплины "терапевт. Стоматология" — 9-е изд. Перераб. И доп. — М. медпресс-информ, 2010. – 924 с.

салова а. в. рехачев в. м. прямые виниры фронтальных зубов: практ. Атлас. — Спб. Человек, 2007. — 80 с.

афанасьев в. в. хирургическая стоматология: учебник для студ. Учреждений высш. Проф. Образования, обучающихся по спец. 060105.65 "Стоматология" по дисц. "Хирург. Стоматология"/афанасьев в. в. адусаламов м. р. богатов в. в. и др.; Под общ. Ред. В. в. афанасьева. — М. гэотар-медиа, 2011. — 880 с.

терапевтическая стоматология. Кариесология и заболевания твердых тканей зубов. Эндодонтия. Руководство к практ. Занятиям максимовский ю. м. митронин а. в.

автор: максимовский ю. м. митронин а. в.

название: терапевтическая стоматология. Кариесология и заболевания твердых тканей зубов. Эндодонтия. Руководство к практ. Занятиям

митронин. Найдено книг

митронин. Найдено книг: 40.

терапевтическая стоматология. Кариесология и заболевания твердых тканей зубов. Эндодонтия. Купить книгу автор: митронин александр валентинович, максимовский юрий михайлович магазин: лабиринт цена: 1294

издательство: гэотар-медиа isbn: год: 2014 страниц: 0

контрольные материалы по предмету "устройство автомобиля". купить книгу автор: в. п. митронин, а. а. агабаев магазин: ozon цена: 498 искать по isbn

издательство: academia isbn: 978-5-4468-0050-6 год: 2013 страниц: 0

фтизиатрия учебник. 2-Е изд. Перераб. И доп. Купить книгу автор: мишин в. ю. митронин а. в. завражнов с. п. магазин: setbook цена: 1544 искать по isbn

издательство: гэотар-медиа isbn: 9785970432297 год: 2015 страниц: 0

клиническая анатомия челюстей. Купить книгу автор: янушевич о. о. митронин в. а. смирнов в. г. магазин: библион осторожно, возможно закрытие цена: 752 искать по isbn

издательство: бином. Лаборатория знаний isbn: 978-5-9518-0570-6 год: 2014 страниц: 0

контрольные материалы по предмету; устройство автомобиля; (3-е изд. Стер.) Учеб. Пособие. Купить книгу автор: митронин в. п. магазин: setbook цена: 321 искать по isbn

издательство: academia isbn: 9785446800506 год: 2013 страниц: 0

фтизиатрия. Купить книгу автор: мишин в. ю. митронин а. в. завражнов с. п. магазин: комбук цена: 1960 искать по isbn

издательство: гэотар-медиа isbn: 978-5-9704-3229-7 год: 2015 страниц: 0

контрольные материалы по предмету "устройство автомобиля". купить книгу автор: в. п. митронин, а. а. агабаев магазин: ozon цена: 359 искать по isbn

издательство: academia isbn

издательство: academia isbn: 978-5-7695-6246-4 год: 2010 страниц: 0

эксплуатация, техническое обслуживание и ремонт автомобиля. Контрольные материалы. Купить книгу автор: т. г. финогенова, в. п. митронин магазин: ozon цена: 394 искать по isbn

издательство: academia isbn: 978-5-7695-9482-3 год: 2012 страниц: 0

терапевтическая стоматология. Руководство к практическим занятиям. Купить книгу автор: ю. м. максимовский, а. в. митронин магазин: ozon цена: 1206 искать по isbn

издательство: гэотар-медиа isbn: 978-5-9704-2387-5 год: 2012 страниц: 0

терапевтическая стоматология. Руководство к практическим занятиям. Купить книгу автор: ю. м. максимовский, а. в. митронин магазин: ozon цена: 810 искать по isbn

транспортировка грузов и перевозка пассажиров. Методическое пособие по преподаванию профессионального модуля. Методическое пособие для преподавателей. Купить книгу автор: митронин в. п. финогенова т. г. федосенко в. в. магазин: библион осторожно, возможно закрытие цена: 912 искать по isbn

издательство: academia isbn: 978-5-7695-9596-7 год: 2014 страниц: 0

клиническая анатомия челюстей. Купить книгу автор: в. г. смирнов, Максимовский ю.м, митронин а.в. терапевтическая стоматология. руководство к практ зан, о. о. янушевич, в. а. митронин магазин: ozon цена: 797 искать по isbn

издательство: бином isbn: 978-5-9518-0570-6 год: 2014 страниц: 0

непереносимость зубопротезных материалов. Купить книгу автор: к. а. лебедев, Максимовский ю.м, митронин а.в. терапевтическая стоматология. руководство к практ зан, а. в. митронин, и. д. понякина магазин: ozon цена: 601 искать по isbn

издательство: либроком isbn

издательство: либроком isbn: 978-5-397-00939-3 год: 2010 страниц: 0

терапевтическая стоматология. Руководство к практическим занятиям. Купить книгу автор: митронин, максимовский магазин: setbook цена: 603 искать по isbn

издательство: гэотар-медиа isbn: 9785970418925 год: 2011 страниц: 4320

техническое обслуживание и ремонт автотранспорта: методическое пособие по преподаванию профессионального модуля. Купить книгу автор: гибовский г. митронин в. останин д. магазин: комбук цена: 767 искать по isbn

издательство: академия isbn: 9785446807635 год: 2015 страниц: 0

терапевтическая стоматология. Кариесология и заболевания твердых тканей зубов. Эндодонтия. Руководство к практическим занятиям. Купить книгу автор: а. в. митронин, юрий максимовский магазин: read. Ru цена: 1116 искать по isbn

издательство: гэотар-медиа isbn: 978-5-9704-2919-8 год: 2014 страниц: 480

эксплуатация, техническое обслуживание и ремонт автомобиля. Контрольные материалы. Учебное пособие для сузов. Купить книгу автор: митронин в. п. финогенова т. г. магазин: библион осторожно, возможно закрытие цена: 342 искать по isbn

издательство: academia isbn: 978-5-4468-1348-3 год: 2014 страниц: 0

производственное обучение по профессии; автомеханик;. учебное пособие — 2 изд. Купить книгу автор: нерсесян в. и. митронин в. п. останин д. к. магазин: библион осторожно, возможно закрытие цена: 611 искать по isbn

издательство: academia isbn: 978-5-4468-0202-9 год: 2013 страниц: 0

производственное обучение по профессии amp; автомеханикamp;. купить книгу автор: нерсесян в. и. митронин в. п. останин д. к. магазин: комбук цена: 574 искать по isbn

терапевтическая стоматология. Руководство к практическим занятиям. Купить книгу автор: митронин александр валентинович, максимовский юрий михайлович магазин: лабиринт цена: 920

издательство: гэотар-медиа isbn: год: 2011 страниц: 0

клиническая анатомия челюстей. Купить книгу автор: смирнов в. г. митронин в. а. янушевич о. о. магазин: комбук цена: 451 искать по isbn

терапевтическая стоматология. Купить книгу автор: ю. м. максимовский, а. в. митронин магазин: books. Ru цена: 688 искать по isbn

издательство: гэотар-медицина isbn: 978-5-9704-1892-5 год: 2011 страниц: 432

производственное обучение по профессии amp; автомеханикamp;. купить книгу автор: нерсесян в. и. митронин в. п. останин д. к. магазин: комбук цена: 663 искать по isbn

издательство: academia isbn: 978-5-4468-0959-2 год: 2014 страниц: 0

фтизиатрия. Учебник — 2 изд. Купить книгу автор: мишин в. ю. митронин а. в. завражнов с. п. магазин: библион осторожно, возможно закрытие цена: 1676 искать по isbn

издательство: гэотар-медиа isbn: 978-5-9704-3229-7 год: 2015 страниц: 0

кариес зубов. Учебное пособие. Купить книгу автор: максимовский ю.

м. митронин а. в. ульянова т. в. гринин в

м. митронин а. в. ульянова т. в. гринин в. м. магазин: библион осторожно, возможно закрытие цена: 176 искать по isbn

издательство: гэотар-медиа isbn: 978-5-9704-0864-3 год: 0 страниц: 0

контрольные материалы по предмету; устройство автомобиля; (4-е изд. Стер.) Учеб. Пособие. Купить книгу автор: митронин в. п. магазин: setbook цена: 290 искать по isbn

издательство: художественная литература isbn: 9785446809547 год: 2014 страниц: 80

контрольные материалы по предмету amp; устройство автомобиляamp;. купить книгу автор: митронин в. п. агабаев а. а. магазин: комбук цена: 321 искать по isbn

издательство: academia isbn: 978-5-4468-0954-7 год: 2014 страниц: 0

терапевтическая стоматология. Руководство к практическим занятиям. Купить книгу автор: митронин, максимовский магазин: setbook цена: 739 искать по isbn

издательство: гэотар-медиа isbn: 9785970423875 год: 0 страниц: 432

фтизиопульмонология. Купить книгу автор: мишин владимир юрьевич, григорьев юрий геннадьевич, митронин александр валентинович, завражной сергей петрович магазин: лабиринт цена: 1316

издательство: гэотар-медиа isbn: год: 2010 страниц: 0

транспортировка грузов и перевозка пассажиров. Методическое пособие по преподаванию профессионального модуля. Купить книгу автор: виктор митронин, т. финогенова, валентин федосенко магазин: read. Ru цена: 878 искать по isbn

издательство: academia isbn: 978-5-7695-9596-7 год: 2014 страниц: 272

митронин. Найдено книг: 40.

.

Маркировать инструкции и24-18-197-89

Маркировать инструкции и24-18-197-89 — этому посвящена страница нашего сайта.

 

Маркировать инструкции и24-18-197-89

Ozon.ru

 

uvasogah’s blog

uvasogah’s blog

02/07/2012

смотреть онлайн бесплатно мультфильм смешарики

смотреть онлайн бесплатно мультфильм смешарики!

скачать бесплатно книгу основы этики смотреть онлайн бесплатно мультфильм смешарики умк + по психологии скачать бесплатно реферат реанимация и анестезиология скачать игру samurai x сайт информационный ресурс папины дочки прстмотр фильма смотреть онлайн бесплатно мультфильм смешарики

аська gt s5230 скачать бесплатно

аська gt s5230 скачать бесплатно!

сверхъестественное 5 сериал скачать аська gt s5230 скачать бесплатно скачать дуэт имени чехова на кпк лучшие школы художественной гимнастики москва инструкция по эксплуатации вентиляционных устройств на объектах здравоохранения текс песни группа 44 — ты не моя население калиниграда скачать картинки с перечеркнутой школой маркетинг скачать лекции бесплатно notre-dame de paris-phoebus текст песни лондонские мечты фильм скачать бесплатно фильм пираты карибского моря 3 3gp аська gt s5230 скачать бесплатно

автореферат и диссертация по ветеринарии (16.00.03) на тему: теоретическое и экспериментальное обоснование применения генетического маркирования возбудителей инфекционных болезней животных в молекулярной эпизоотологии

автореферат диссертации по ветеринарии на тему теоретическое и экспериментальное обоснование применения генетического маркирования возбудителей инфекционных болезней животных в молекулярной эпизоотологии

?на правах рgt; копией

0030643 1э

cl mi 1п1хи11 владимир иванович

cl mi 1п1хи11 владимир иванович

11 орпич1 ск01 и экспериментально! Обосновании применения еенетическоео маркирования возбудигелси инфекционных ь0л1 знейживошых в молекулярной 011и300 iojioi ии

16 00 03 — ветеринарная микробиология, пирсотогия )пи юотоюгия,

микотогия с мпкотоксикологией и имм iiojioi пя 03 00 23 — биотехнология

автореферат

ihclepianhii па соискание ученой cienenu юмора биоло! Ическнч на к

d 2 авг2007

новосибирск — 2007

003064319

рабсил вынотнепа в i ну инсии> i экспериментальной ветеринарии сибири и дальне! О восюка со россельхозакадечии

научный консу ibiam домор ветеринарных паук, профессор,

академик россе тьо ?академии, «служенный деятель науки рф донченко александр семенович

официальные опгюнеигы докюр вегерипарных наук, профессор

димов сергеи копсгап тинович i i 1у ювс идв с о россетьхо ?академии

докюр био 101 нческнх наук, ciapunin на чныи coipy чип к ьетявская валентина александровна, ф1 ун i 1щ вь «вектор»

докюр биологическич наук, профессор об>ов miорь леонидович, фгу вгнки

ведущая организация всероссийский паучно-песпедовате 1ьскпй илстшу i вегеринарнои вирусо юг ни и микробиологии (внииввим, г покрои)

загтпа сосгоигся «_»_200_ г в «_» часов на заседании

чиссерганионного совета д 006 045 01 в государственном научном учреждении институт экспериментальной ветеринарии сибири и дальнего востока с о россетько?академии но адрес) 630501, новосибирская обгаегь новосибирский район, и краснообск, со россечьхозакацемии гпу иэвсндв

с диссергацией можно ошакомиться в цнсхь

с диссергацией можно ошакомиться в цнсхь со россельхо ?академии

авгорефераг pasocian «_»_200_ г

ученый секретарь ___

диссертационного совета i г м стеблева

1 общая характеристика работы

актуальность проблемы основными объектами и точками приложения молекулярной эпизоотологии являются индикация, дифференциация и полиморфизм патогенных микроорганизмов в изучении их структуры мрнк и днк получили распространение методы генетического маркирования, основанные на полимеразной цепной реакции днк (б льюин, 1987, ю п алтухов, Маркировать инструкции и24-18-197-89, 1989, ю п алтухов, Маркировать инструкции и24-18-197-89, jt и корочкин, ю г рычков, Маркировать инструкции и24-18-197-89, 1996, забаровский е р. 2001)

в последние годы список днк-маркеров был заметно увеличен, благодаря привлечению молекулярных маркеров, Маркировать инструкции и24-18-197-89, основанных на различных модификациях пцр (с wong, w wilson, a j jffereys, s l thein, 1986, io п алтухов, Маркировать инструкции и24-18-197-89, 1989, с a булат, h в мироненко, 1989, ге сулимова. Г о шайхаев, Маркировать инструкции и24-18-197-89, э m берберов, Маркировать инструкции и24-18-197-89, а ю маркарян, л г кандалова, 1991, ю п алтухов, Маркировать инструкции и24-18-197-89, 1995, j chen, р d hebert, 1998)

молекулярно-генетическое маркирование заключается в выявлении специфических последовательностей днк, способных охарактеризовать организм с одной стороны как набор отдельных генов, Маркировать инструкции и24-18-197-89, отвечающих за те или иные признаки, а с другой как целостную генетическую структуру, отличающуюся от других на молекулярном уровне (г е сулимова, г о шайхаев, Маркировать инструкции и24-18-197-89, э m берберов, Маркировать инструкции и24-18-197-89, а ю маркарян, л г кандалова, 1991, ер забаровский, 2001, er zabarovsky, l petrenko, a protopopov, o vorontsova о et al, 2003)

c meci в ici мономорфное и иопиморфное мрнк и днк маркирование, при мономорфном маркировании помимо обычной двух праймерной пцр для трудно амплифицирусмых участков днк, а также в тех случаях, когда матричная днк прису rcibci в следовых количествах, пцр проводят в два раgt; нда, ю есть иснолыую! Систему, i ак на!

ываемы вложенных (nested) праимеров (i

ываемы вложенных (nested) праимеров (i a uioisman, 11 othman, 1993, в f clieetham, m h kat/, 1995, io m романова, aji 1 шибург, 1999 kl моцыналиев, Маркировать инструкции и24-18-197-89, в m i оворун, 2000) i tin возникает необходимой ь icnei нческого маркирования по нескольким генам в одной реакционной сре ге, ю проводится му н. тииранмерная пцр с использованием нсскотьких пар праимеров таким образом, осуществляется скрининг сразу по нескот), ким генам (с рagira, m morcante, 1998)

другим вариантом днк-маркеров являются полиморфные маркеры, основанные на тестировании однонуклеотидных замен (snps) с помощью пцр-пдрф анализа (г е сулимова, г о шайхаев, Маркировать инструкции и24-18-197-89, э m берберов и др. 1991, Ге сулимова, иг удина, г о шайхаев, Маркировать инструкции и24-18-197-89, и а захаров, Маркировать инструкции и24-18-197-89, 1995, иг удина, е е карамышева, с о туркова и др. 2003)

особый класс полиморфных днк-маркеров основан на использовании праимеров, Маркировать инструкции и24-18-197-89, имеющих множественную локализацию в геноме это может быть достигнуто при использовании одного короткого праймера с произвольной последовательностью, так называемый rapd-анализ (m р snyder, d kimbrell. M hunkapiller, 1982, e nevo, a beilis, r ben-shlomo, 1984, ca булат, о к кобаев, Маркировать инструкции и24-18-197-89, hb мироненко, фм ибатулин и др. 1992, Rd ward, d о f skrbmski, m woodwark, 1992, j g к williams, m к hanafey, ja rafalski, sv tingey, 1993, и а шагинян, ал гинцбург, 1995, юп алтухов, Маркировать инструкции и24-18-197-89, 1995) в доступной отечественной литературе на начало наших исследований отсутствовали сообщения по мрнк и днк-маркированию вирусов кчс и вд крс, а также

культур ризоьааепшп песгорьогит и мусорыт

культур ризоьааепшп песгорьогит и мусорыт с целью их дифференциации по родам, что и определило цель и задачи исследований

цен, и ??пачи исследований является теоретическое и экспериментальное обоснование применения различных типов генетического маркирования ну кчеошдных пос ледова гелънос1 ей возбудителей инфекционных болезней животных на примере ктассической чумы свиней, вируса вирусной диареи крупного рогатого скота, нскробактериозаи микоплазмоза

для достижения посгавпеннои цепи определены спедующие задачи

1 теорешчсски обоснован использование различных гшюв генетическою маркирования нукпеотидных поспедовательностей возбудителей инфекционных бопезнсн животных и области их применения

2 разрабоипь способы сбт-рнк мономорфного маркирования мрнк вируса классической чумы свиней и вируса вирусной шарен крупною ро1 а 101 о ско1а

3 разработать ь7 8ь-д11к мономорфного маркирования геномной д11к ривоьайепшп песгорьогит на основе мобильного элемента с помощью гнездовой пцр, а также способ нитрования цпаммов и изолягов ризоьасчегшт песгорьогит при помощи пдрф-пцр

4 разработать способ для мономорфного ьтьб-дпк генотипирования с помощью мутьгипраимерион пцр для выявления генетических признаков культур ричоьас1епшп песгорьогит

5 разработать бм-маркирование на основе каро-пцр с праймерами имеющими множественную локализацию в геномах гизоьайепшн песгорьогит и мусор1ачт

6 изучить полиморфизм мономеров культур ризоьайепит песгорьогит

научная новизна

научная новизна

— разработай способ сят-рнк мономорфного маркирования нуклеотидиои последовательности в консервативной обласш мрнк вируса классической чумы свиней с помощью от-пцр, позволяющий выявлять большее чиспо вариантов вирусов циркулирующих как в i вропеиеких, так и в дальневосточных регионах рф (патент 2120994 от 27 октября 1998 )

— разработан способ ря1-рнк мономорфного маркирования нуклеотпдной посаетоватепьности в консервативной обтастп мрпк вируса вирусной тиареи крупного рогатого скота с помощью от-пцр позволяющий чиффереицированно по 01 ношению к ктассическоп чуме свиней выявлять персистепцию ною вируса у свиней (патент 2158306 01 27 октября 2000 т )

— впервые в рф разработан способ stss-дi пч мономорфного маркирования пукпеогидных поспедовательностей гггчоьасгепит песгорьогит на основе мобильного элемента с помощью гнездовой пцр, но ?воняющий выявчягь патогенные подвиды i иьоьааепит песгорьогит (патент 2203951 от 10 мая 2003 г )

— впервые в рф разработан способ мономорфного ьтбя- генотипирования i нчоьасгепштг песгорьошт с помощью мулминраймерной пцр, позвопяющий проводить обнаружение генетических признаков характерных дтя патогенного подвида гшоьас1егшт песгорьогит виьзрестея песюрьогит, обладающих патогенным свойством агглютинировать эритроциты (патент 2294374 01 27 февраля 2007 г)

— впервые в рф разработаны способы кар1)-!1цр для полиморфного маркирования купьтур гибоьастегшт песюрьогит и мусорьэт с номощыо

праимеров 38/1 и 39, позволяющих разграничивать

праимеров 38/1 и 39, позволяющих разграничивать их по кластерам с мипима 1ьнымн [енегическммн дистанциями

— впервые в рф изучен полиморфизм мономеров кулылр 1 usobacterium necrophorum, данные которого помогут в определении изменчивости под воздействием раничных факторов и закономерностей в циркуляции эпизоотических штаммов в стадах

— дана биологическая и генетическая характеристика депонированным штаммам бамерий rusobacterium necrophorum subspecies necrophorum 12tsk630501 нии kkm гнц вб «векюр» в-1076 и 8ts630501 нии ккм гнц вб «вектор» в-1075 приточных для изготовления диагностических и защитных препаратов против некробактериоза животных ( справка фгуп гнц вб «вектор» 1805 or 8 сети 2005 г на цп 12tsk630501 справка фгуп гнц вб «векюр» 1705 01 8 сеш 2005 i на шг 81s630501)

теоретическая и практическая значимость работы

результаты исследований представляют теоретическую и практическую ценность, так как создают перспективы применения молекулярных маркеров для мономорфного и полиморфного маркирования, основанные на различных модификациях пцр (от-пцр, гнездовая пцр, пдрф-пцр, мультиплексной пцр и rapd-пцр) для использования в молекулярной эпизоотологии, где главной точкой приложения является изучение изменчивости патогенных микроорганизмов сведенияполучаемые с помощью генетического маркирования составляют научную основу молекулярной эпизоотологии мономорфное и полиморфное маркирование применяется не только в диагностике, но и при идентификации, генотипировании изолятов и генетическом картировании культур возбудителей болезней животных, в том числе классической чумы свиней, вируса вирусной диареи крупного рогатого скота, некробактериоза и микоплазмозов

потучены ипаммы бактерий rusobacterium

потучены ипаммы бактерий rusobacterium necrophorum subspecies neciophorum i2isk630501 нии kkm i нц вб «вектор» в-1076 и 8is630501 нии kkm i нц вб «вектор» в-1075 указанные штаммы расширили арсенал ипаммов бактерий tusobactcnum necrophorum subspecies necrophorum, которые moiyi бьиь испопьзованы для изюювлеиня диагностических и профилактических препарате против некробактериоза животных на ич основе можно прово птть дифференцирование выделенных иютятов от других анаэробов, Маркировать инструкции и24-18-197-89, морфологически схожих с rusobacterium necrophorum, проводить разграничение па подвиды subspecies neciophorum и subspecies lundulifoime и прово лиь подбор производственных культур для изготовления защитных препаратов

получаемые данные с помощью днк- маркирования на основе пцр с праймерами, имеющими множественную локализацию (rapd- анализ) в геноме культур fusobacterium necrophorum и mycoplasm и белковому полиморфизму на основе 10 ds-na-пааг анализов возможно использовать в популяционной генетике и молекулярной эпизоотологии для оптимизации противоэпизоотических мероприятий, подбора референтных штаммов

материалы диссертации нашли отражение в нормативных документах инструкции «тест-система для выявления fusobacterium necrophorum subspecies necrophorum методом полимеразной цепной реакции с помощью гнездовых праймеров» и ту 9388-001-05095732-2006 (свидетельство о государственной регистрации пвр-1-2 6/01846 от 20 февраля 2007 г учетная серия 35-1-2 61495) и были использованы при составлении методических рекомендаций

— «взятие и доставка проб сыворотки и патологичебского материала для лабораторной диагностики вирусных болезней животных» рассмотрены и утверждены ученым советом гну иэвсидв со расхн (1987),

— «выдепение геномной днк rusobacteuum necrophorum из биологических образцов» рассмотрены н у гверждены ученым советом гну иэвсидв со расхн (протокол л! gt;1 ог 22 февраля 2002 г) и подсекцией секции инфекционной патологии отделения ветеринарной медицины россельхозакадсмни «проблемы инфекцтюннои патологии животных в регионе сибири и дальнею востока» (прогоко г 3 ог 22 февраля 2002 i )

— « выделение рнк вируса вирусной диареи крупного рогатого скота и индикация методом позерн-блот гнбридизапиен» рассмотрены и утверждены ученым совеюм гну иэвсидв со расхн и подсекцией секции инфекционпои иатоюнш отделения ветеринарной медицины россе гько; гка гемии «проблемы инфекционной патологии животных в регионе с ибнрп и дальнего востока» (2002),

— «применение тест-системы для выявления патогенных fusobactenum necrophorum методом совмещенной гнездовой полимеразггой цепной реакции (two m one nested pcr» рассмотрены и утверждены ученым соретом гну иэвсидв со расхн и подсекцией «инфекционная патология животных в регионе сибири и дальнего востока» отделения ветеринарной медицины россельхозакадемии (2006),

— «применений тест-системы для генотипирования культур fusobactenum necrophorum методом мультиплексной одношаговой полимеразггой цепной реакции (пцр)» рассмотрены гг утверждены ученым советом гну иэвсггдв со расхн и подсекцией «инфекционная патология животных в регионе сибири и дальнего востока» отделения ветеринарной медицины россельхозакадемии (2006),

«применение каргмщр апатии дня чолекхлярно

«применение каргмщр апатии дня чолекхлярно-генетического

картирования культур [ usobacteuum necrophorum» рассмотрены »утверждены ученым совеюм гну иэвсидв со расхн и подсекцией «инфекционная лаю39; ютпя животных в pcnioiit сибири и дальнего востока» отделения вегеринарнои медицины россельхозакадемии (2006)

апробация работы материалы диссертационной работы доложены на заседаниях учсного совета гну иэвсидв со расхн ( новосибирск 1999-2005), 111 всесоюзной конференции гго эпизоотологии (новосибирск 1991) международной научно-прак птчсской конференции (новосибирск, 1999), паучно-пракшческои конференции (новосибирск, 1998, 1999), з-си международная научно-практическая конференции (алматы 2000), научно-практической конференции «внедрение ресурсосберегающих технологий в сельскохозяйственном производстве» (новокузнецк 2000), научно-практической конференции «болезни сельскохозяйственных животных вирусной и друтих ллолоптй п меры борьбы с ними» (иркутск 2001) меж iy наро той научно-практической конференции «ьнолото-экологические проблемы заразных болезней диких животных гг их роль в патологии сспьскохозяиственных животных и людей» (покров, Маркировать инструкции и24-18-197-89, 2002), на 5-ои меж г наро той нау чно-нракт ической конференции «научное обеспечение апк сибири монголии, казахстана bciapcii и башкортостана» (новосибирск, 2002) 1- ом меж чу народном котирессе «актуальные проблемы в развития ветеринарной пауки и пракшкп» (алмагы, 2002) международной пау чпо-гтрактическои конференции «ветеринарные и медицинские аспекты зооагротгонозов» (покров 2003) ме/кд народной научно-практическом конференции «современное состояние и актуальные проблемы в развитии ветеринарной науки и практики» (алматы, 2005), на п-ой международной конференции моюдык ученых

«новеишпе направления развития аграрной

«новеишпе направления развития аграрной пауки в работах молодых ученых (новосибирск, 2006)

плбчмклии» пезх и. таюв исследования i lo теме диссертации опубликовано 44 печашых рабены в том числе 17 статей в ведущих научных журналах, рекомендованных вак минобрдювания рф («доклады российской академии се тьскохозяйственныч наук», «мо текулярная генетика, микробиология и вирусология», «сибирский вестник сетьскохозяйственных наук»), в которых полностью отражено содержание работы, а также в сборниках научных трудов и друтнх пачиых трудах и изданиях

ooi. Cm и cipkipn чнссегпаини диссертация пложена на 418 страницах машинописного текста и состоит из введения, обзора литературы, собственных исследований, обсуж тения, выводов практических предложений, списка литературы и при южения работа иллюстрирована 43 рисунками и 2с? таблицами список титерагуры включает 409 отечественных и зарубежных источников основные положении, выносимые на защип

— теоретическое и экспериментальное обоснование днк-маркирования в теистических исследованиях типы маркеров их свойства и области применения,

— способ 1 st-p11k моиоморфного маркирования экспрсссирующихся нос тсчовагельностеи мрпк вируса классической чумы свинеп с использованием 01-пц139;,

способ для slss-днк мономорфнот о маркирования нуклеогндных нос те тователтлюстеп rusobacterium necrophoium на основе мобильного эчемента (транснозона) с использованием шездовои и мулыитт тскснои пцр,

— способ snps-mjpmiponjhiw на основе rapd-iihp с пранмерами, имеющих мпо/ксстветпту то тока птзацпю в геномах husobactenum necrophoium и mycoplasm

теорегттческпи анализ, обобщение результатов

теорегттческпи анализ, обобщение результатов, Маркировать инструкции и24-18-197-89, экспериментальные исследования выполнены автором самостоятечьно

автор выражает глубокую благо ырность за участие в выполнении некоторых фрагментов диссертации а а самоловову, сф орешковой, да хузину. N4 а фипппепко с храиову, а в мокеевой, а также сотрудникам лаборатории с а юрик и н в некрасовой

2 собственные исследования 2 1. материалы и методы

работа выношена в 1991-2006 тг в лаборатории генной инженерии гну ювспдв

культивирование клеток рк-15, заражение их вакцинным штаммом вируса классической чумы евинеи (кчс) лк-внииввим осуществляли согласно «методическим указаниям по иммуиофлуоресцентной диагностике классической ч39; мы свписи» (москва, 1984) и «методическим указаниям но табораторпой диагностике классической чумы свинеи» (москва, 1996) также использовали перепиваемую ку тыуру клеток mdbk культивирование кпеюк, заражение их вакцинными штаммами вирчеа вирусной диареи вк-1 — вюв и орегон с-24 v осмцсст впяли cor таено рекомендациям по серодиагностике вирусных инфекции (сторин в н. ье юу сова р в. фомина ii в. 1991)

в нача те исследовали культуры ь necrophorum, выделенные сотрудниками лаборатории по изучению некробактсриоза животных самотововым а а, лопатиным с в и переданные в лабораторию теиной инженерии гпу иэвсидв культуры были иолчены ог больных животных на территории западной сибири

1 — кемеровская область — к (кемерово), 3 — гну иэвсидв — м2, 4 -новосибирская обтасть, коченевсксно района — кр, 5 и 6 — нсо, новосибирского района — 5р и 6р (раздольное), л1gt;7 — алтайский край — атт 8 -томская обтасть — 42тс (свинокомплекс), а также изо тят «чик-1020» oi ботыюн коровы коченевскот района нсо в качестве реферешиыч использовали культуру 2 из ви1в — 21? тюбезно представленную караваевым и купьгуру 3430 вгнки в дальнейшем исследовали 40 культр i necrophoium любезно представтенные нам сотрудниками сектора конгротя и сгандаргизацнн бионренараюв всероссийскою паучно-нсследовательског о beiepnnapnoio института (г казань) макаевым и x ii, ху зиным д а бактерийные культуры были выделены от животных на территории татарстана, башкортостана, марий 39; ж удмуртии, ульяновской и самарской обласгей по клиническим показаниям для подтверждения специфичное! И гютимеразной ценной реакции непочьзовали референтные штаммы е sehcrichia coll атсс 25922, streptococcus, pyogenes (гр а), staphylococcus aureus атсс 25923, pioteus vulgaris (полевой штамм) bacillus subtihs тнп-3 salmonella dublin 373 315/52 предаав темные софдннками лаборатории по изучению болезней молодняка сельскохозяйственных животных гну иэвсидв со расхн

при д111lt;-маркирова1иш микоплазм использовали

при д111lt;-маркирова1иш микоплазм использовали референтные штаммы м boigenitahum, м bovimastitidis м bovirhmis, м alcalescens, м mycoides м aigmini, потученные из лаборатории по изучению болезней молодняка сетьскохозянстиснных животных гну иэвсидв со расхн а также культуры, вылеченные от коров с патологией воспроизводигелытоп функции в опх «этитное» 6-01,11-01,12-01 выделены в 2001 г, а 15-03, 16-03 9-03 01-03 в 2003 г культивирование микоптазм осуществили в соответствтги с методическими указаниями но лабораторной диагностике, приведенные в «справочнике по мнкробиоло! Ическим и вирусологическим меюдам исследования» пот ред м о ьиргсра (1982) все мпаммы и кутьтуры были протестированы 11цр — системой «м1-1к-ком» кат vlt-4 цнии эпидемиологии мз рф

выдепение геномной рнк вирусов классической чумы свиней п вирусной диареи крупного рогатого скота (вд крс) проводили с применением 6 м оанидннтиоционата и дополнительпоп тепротеинизациеи смесью фенола с хпороформом и осаждением мрнк эшпопом

выделение днк f necrophorum из биологических образцов проводили в двух вариантах в первом варианте при выделении суммарной днк с использовали нротеипазу к (10 мг/мч) во втором гарианте выдепение суммарной днк проводили 10 став качество полччаемою npenapaia нуклеиновых кислот проверяли путем тндроптза _gt; нтонуклеавами, приобре! Енных в ооо «сибэнзим», в рс/кнмах, рекомендуемых производитетем

выделение днк mycoplasm проводили путем лизиса ткани гуанидинизошоцпоанатом с тгое геиующеп сорбцией днк на стеклянном носителе

для определения нктеоттпной посте юватетьности и анализа праймеров при маркировании мрнк вирусов кчс и вд крс был применен пакет программ alignment seivice v4 0 ol1go 4 0 и gencncr. А также отобранные опубликованные тхлеошдные not39; кчова тельной и некоторых штаммов вирсов кчс штамм alfort (meyers g rucmenapt t and thiel ii-i, 1989), штамм biescia (moormann r i, wannerdam p a. van der mcer в schaper w m. wensvoort g and ilulst mm, 1990), штамм; weibrid ncbi gi 297783;( muyldeimans g,

san gabriel m. caij л. de smet a and hamers

san gabriel m. caij л. de smet a and hamers r. 1993), изолят mchv с таивапя (chang y 1993), н bvdv шгамм osloss(de moerlooze l lecomte с m. brown-shimer si et al. 1993), Штамм sd-l(dcng r, brock kv, 1992) штамм nadhcollct ms, larson r, gold с et al, 1988), штамм oiegon (pellenn с, mon s lecomte 1 ti]ssen p 1993)

анализ фрагментов нуклеотидных последовательностей i usobacterium necrophorum и определение последовательностей праймеров для гнездовой 11цр проводили с помощью тех же программ

уаанов ieime д 1я му шптилекспои пцр пос ?едова?ельностем праймеров 210-220 с целью выявления фрагмента i сна белка оболочки (гров) в 906 нп, 215-2I6gn гена фермента днк-гиразы (dna- gyrase в protein gene, lonoiiiomepaia п) в 370 un, 180-191 тепа i емап лтопшина (omph) в 645 нп и 17-19 спенсера (вставки) i6s-23s леикотоксина f necrophorum в 228 нп проводили rio алгоритму выравнивания нуклеотидных последовательностей в программах blast с использованием базы данных genbank одновременно в реакции применяли две или три пары праймеров одна пара праймеров д ш выявления гемагыюшнина была постоянна, а другие менялись

при проведении rapd-анализа днк rusobactenum necrophorum «произвольные» прапмеры длиной в 10 пук1сотпдов выбирали, взяв за основу пук 1соп1дную последовательность тейкотокстша f necrophorum штамма а25 (ai 3 12861);

д тя r apd-чаркнрования днк штаммов и культур микоппазм использовали «произвольные» праимеры со с1учайнои нуклеогидной носледовательное 1ыо ллиноп в 10 нук1сотщов сконструированные на основе днк генов mhp3 mgp (оттерон mgpa) mycoplasma bovigenitahum

химическим синтез всех специфических и

химическим синтез всех специфических и произвольных праймеров был осуществлен амидофосфтпным методом па автоматическом синтезаторе asm-102u (biosset ltd, новосибирск) в отделе химии природных соединений фгун i нц вь; вектор; россельхозпотрсбиадзора мз рф

постановку иолнмеразиои цепной реакции осуществляли на амплификаюрах; ьнс; м-105 и; герцик; по общепринятым методикам (р с39; анкн и др. 1990, В г дсбанов 1990, а ь вартапетян, 1991)

анализ полученных результатов в пцр проводили методом электрофореза в 1 5-2 0; |gt; aiapo3iioi теле при силе тока 25-40 ма в течение 30-50 мин (т маниатис и др 1984) в качестве маркера использовали днк pljcls тидролизованную alui (на фрагменты 667, 521, 251, 226 п 131 нп) или маркер ооо «сибонзим» 100 bp 39; 1,5 kb, также маркером сижила днк pqpr гидро тизовапиая пае! П документирование полученных результатов проводили с помощью цифровой фотокамеры

количественную оценку различий между изолятами проводили путем попарного сравнения паттернов расчет индексов подобия d осуществляли аналогично, используя формулу dab 2nah/(na + nb), где na и nb — число фрагментов днк в дорожках а и b соответственно, a nab _ число совпадающих по электрофоретической подвижности фрагментов в дорожках а и b (v miteva, a abadijeva, r grigorova, 1991) для проведения статистического анализа были составлены бинарные матрицы, которые использовали для построения дендрограмм методом кластерного анализа (statistica 6) в результате получали дендрограмму генетических расстояний

полиморфизм очигомсров г necrophorum биодогические

полиморфизм очигомсров г necrophorum биодогические пробы на белых мышах провочн ш couiacno «меюдическим указаниям по чабораюриоп диагностике нскробактериоза» (москва 1487) в каждой из 3-х групп было по 3 животных весом 18-29гр заражение бе ibix мышеи осуществляли подкожной инъекцией в области корня хвосга в объеме 0,6мл 16 часовой культурой г neciophorum в еле ту тотцич варкам тах 1 опыт — культу ральной средой с бактериями, 2 опыт — бактериями отмытых физтточогпческнм раствором, 3 опыт -культу ральной средой без бактерии в каждом опыте животным контрольной группы i вводили физнолотический раствор, а кош рольной труппы 2 -культуральную среду без выращивания в ней бактерий наблюдение дчнчось 1 ! днен затем животных выводили из опыта

изучение попиморфнзма бе ikob с помощью 10 ds-na-плаг ана тизов, Маркировать инструкции и24-18-197-89, основанное на определении молекулярной массы мономеров, Маркировать инструкции и24-18-197-89, получаемых при диссоциации исходного отигомера (белка) поч возденетвнем денатурирующего агента дсп (додецилсульфата натрия) проводили по общепринято» методике в описании маниатис т. фрич э. сэмбрук д. ?984 и гловер д (1989)

схемы проведения экспериментов и меточики исследовании приведены по мере издоления материапов собственных исследовании в начале соотвсгствутощих подраздетов диссертации

2 2. результаты исследований

2 2 1. теорсгнчсскос обоснование применения различных птпов генетического маркирования нукчеотидных иоследоватсчышстен возбудителен инфекционных бочезнеи животных

молекулярная эпизоотология, предметом изучения

молекулярная эпизоотология, предметом изучения которой являются молекулярные механизмы, составляющие основу развития эпизоотического процесса, входит в контекст общей эпизоотологии основными объектами приложения молекулярной эпизоотологии являются индикация, дифференциация и полиморфизм патогенных организмов

теоретической базой днк-маркирования является концепция комплементарное™, где основным механизмом выявления полиморфное™ является гибридизация это позволяет тестировать генетический полиморфизм непосредственно на уровне генов, Маркировать инструкции и24-18-197-89, а не на уровне продуктов генов, Маркировать инструкции и24-18-197-89, как в случае использования метода белкового полиморфизма применение днк-маркеров решает проблему насыщения генома маркерами, и маркировать практически любые участки днк, в том числе не кодирующие кроме того, эта маркерная система дает возможность использовать для анализа любые ткани и органы, независимо от стадии развития организма и имеет целый ряд преимуществ по сравнению с другими типами маркеров для этого применяются молекулярные маркеры мономорфного и полиморфного вариантов, Маркировать инструкции и24-18-197-89, основанных на различных модификациях пцр от-пцр, гнездовая пцр, пдрф-пцр, мультиплексной пцр и rapd-пцр

за прошедшие годы было доказано, что полиморфизм в природных популяциях поддерживается известными микроэволюционными факторами -точковыми мутациями, микроделециями, миграцией, случайным генетическим дрейфом и естественным отбором, взаимодействующими в различных сочетаниях в дальнейшем спектр возможных причин был расширен, и в настоящее время основная роль отводится таким факторам, как крупные делеции и вставки,

трансверсии, транслокации, но также присутствием

трансверсии, транслокации, но также присутствием отдельных фрагментов днк, так называемым мигрирующими или подвижными элементами они имеют специальную структурную организацию, которые могут перемещаться в геноме (mp snyder, d kimbrell. М hunkapiller, 1982, e nevo, a beilis, r ben-shlomo, 1984, rd ward, dof skibinski, m woodwark, 1992, юп алтухов, Маркировать инструкции и24-18-197-89, 1995, забаровский e p. 2001)

при анализе опубликованных нуклеотидных последовательностей микроорганизмов было установлено, что по ряду компонентов геномной днк разные виды и подвиды бактерий имеют совпадения, несмотря на значительные различия в основных проявлениях вирулентности поэтому эти компоненты не могут служить элементами маркирующих тест-систем с высокой специфичностью и не вполне пригодны для генетического маркирования внутри вида и подвида поэтому было обращено внимание на нуклеотидные последовательности подвижных элементов (транспозонов) и вставок (is-элементы) между генами (е a groisman, н ochman, 1993, bf cheetham, me katz, 1995, юм романова, а л гинзбург, 1999)

по сравнению с фенотипическими и белковыми маркерами молекулярные днк-маркеры затрагивают саму основу всех процессов происходящих в живых организмах в целом, молекулярно-генетическое маркирование заключается в выявлении специфических последовательностей днк, способных охарактеризовать организм с одной стороны как набор отдельных генов, Маркировать инструкции и24-18-197-89, отвечающих за те или иные признаки, а с другой как целостную генетическую структуру, отличающуюся от других на молекулярном уровне использование подобных маркерных последовательностей имеет большие перспективы связанных с изучением генетических ресурсов организмов и их использованием

landegren u, kaiser r, caskey с, hood l

landegren u, kaiser r, caskey с, hood l (1988), вартапетян а б (1991), аксенов m io. Гинцбург а л (1993), сулимова г e. удина и г. шайхаев г о, захаров и а (1995), моиыналиев kt. Говорун в м (2000), орешкова с ф (2002), алтухов ю а. салменкова е а (2002), жимулев и ф (2006) в своих публикациях сообщили о принципах и использовании возможных вариантов пцр в маркировании нуклеиновых последовательностей различные модификации метода пцр легли в основу создания разнообразных типов днк-маркеров, Маркировать инструкции и24-18-197-89, широко используемых в настоящее время в различных областях биологии и медицины днк- маркеры можно разделить на две группы рассмотрим несколько вариантов днк-маркеров, Маркировать инструкции и24-18-197-89, основанных на полимеразной цепной реакции

мономорфные днк-маркеры stss-маркеры (sequence tagged sites) для данного типа маркеров необходима известность нужной последовательности нуклеотидов и не-встречаемость ее в других геномах например, транспозоны (irap — inter-retransposon amplified polymorphism), is- вставки, днк повторы можно рассматривать как мономорфные днк-маркеры их используют в экспериментах, когда наличие полиморфизма не требуется и часто используют при разработке диагностических тест-систем по выявлению специфического фрагмента днк варианты stss-маркирования — это гнездовая и мультипраймерная пцр при маркировании днк fusobacterium necrophorum

est-маркеры (expressed sequence tags) одной из разновидностей stss-маркеров являются est-маркеры и представляют собой маркеры к экспрессирующимся последовательностям генов при создания est-маркеров использовали нуклеотидные последовательности комплементарные мрнк кднк,

получаемые с помощью обратной транскриптазы

получаемые с помощью обратной транскриптазы на основе изолированной из вирусов геномной рнк вирусов кчс и вд крс

полиморфные днк-маркеры пдрф-пцр (полиморфизм длин

рестрикционных фрагментов ампликона) метод основанный на тестировании однонуклеотидных замен в синтезируемых ампликонах и применяли при идентификации культуры f necrophorum

rapd-пцр анализ к этому типу полиморфных маркеров принадлежат днк-маркеры на основе пцр с праймерами, имеющими множественную локализацию в геноме использовали в популяционной генетике fusobactenum necrophorum и mycoplasm

таким образом, применение в эпизоотологии молекулярного маркирования генетического материала и оценке его на новой теоретической основе составляет предмет специальной отрасли знания — молекулярная эпизоотология основными объектами и точками приложения молекулярной эпизоотологии являются индикация, дифференциация и изменчивость патогенных организмов в последние годы в изучении структуры мрнк и днк получил распространение методы генетического маркирования, основанные на полимеразной цепной реакции днк в экспериментальных исследованиях на примерах разного типа патогенных микроорганизмов была показана возможность с помощью разного типа генетического маркирования осуществлять их индикацию, идентификацию и изучать изменчивость

2 2 2 экспериментальное обоснование пршшпнов мономорфною и полиморфного маркирования возбуди гелеи бопезнн животных

2 2 2 1 lst-маркирошшнс экспрессчрующихси последовательностей мрнк iciiob вирусов кчс н вд крс

ьыла выбрана область послелователыюстсй генома вируса кчс и вируса вд крс, соответственно кодирующие белыт-прелшественники i пикопротенна gp44/48 и g33 3aiem провели выравнивание нуклеотпдных последовательностей gp44/39;48 фрагментов из i еночов различных штаммов кчс несмотря па ю, что при сравнении друг с другом различные штаммы вируса обнаруживают гетерогенность, были выбраны наиболее томоютпчпые участки тепома вируса для синтеза олш онуклеошдных пранмеров (рис 1), применение которых в методе от-пцр

llamp 539;-ataactcaatggaacctg

llamp 539;-ataactcaatggaacctg-339;

alfopt agccgagaacatatcaatggaacctgagtgacaacggc 1200

presci? A t a t 1197

ь eiерid a t 11q6

tajvan —- at t 36

12rev 339;-gcatcagtgggtccggtc-ь39;

at.-Ort taccgatgtcaacgtggtcacccaggccaggaataggcca 1560

c сia g t ca t а с 1557

weibrid g t ca t а гс 155c

39; га39; van cg t ca. А с 3 96

рис 1 — фрагменты выравненных ну к теотидных последовательностей вируса кчс, имеющих наибольшее сходство между собой

позвочичо бы выявить все доступные нам изоляты вируса кчс выбрав с учеюм коми 1еменгарносп1 и ровня свободной энергии ираймеры 12яеу 339;-дсаьсад1ддд!-С: дд1: с-. и 1 1аптр 5 1 -а! аас.1; Саа1ддаассд-3 39; и проведя реакции от-пцр, мы получит специфические для мрнк вируса кчс протукты синтеза- фрагменты кднк в 252 нп затем провели тестирование вируса в пробах полученных от свиней различных свинокомплексов; кудряшовскии; новосибирской,; север; тюменской обчастеи и; красный октябрь; красноярскою края пагочогическли материал (образцы селезенки, лимфатических у зтов, Маркировать инструкции и24-18-197-89, ночек и легких) был взят от животных, у которых наблю тачась кчтгническая картина заболевания классической чумой свиней выявление вируса вели методом от-пцр, исгючьзуя ираймеры 12 и 11 в сравнении с рпи па культуре клеюк рк-15 во всех анализируемых пробах быч выявпен вирус кчс результаты выдечения вирусов на культуре клеток совпачи с данными, полученными в от-пцр (табл 1)

рсзулыаты, проведенных экспериментов показывают, что положительные анализы продуктов пцр почучают только ют да, когда в качестве матрицы испочьзуют кдпк классической чумы свиней аначизы были отрицательными, когда использовали кд11к вируса вирусной диареи крупного рогатого скота

табчица 1 резучьтаты сравнительного исследования

табчица 1 резучьтаты сравнительного исследования биологических образцов

в рпи на культуре клеток рк-15 и от-пцр

наименование исследовано мегочы исслешвлиил

хозяйства проб от-пцр культ клег рк-15 в рпи

с-з «север» 2 1 и010ж1псты10 1 положительно

с-з«1р октябрь» 5 3 по юли le 1ыю 3 положи т елыю

с-з «кудряшовскии» 10 10 по тоlt; кте 1ьно 10 почожителыю

вирс вд крс ни I5k-1 виов 3 3 отрицате 1ьно не нее течовл39; ш

вирус кчс un лк-нпииииим 3 3 почожпге 1ыю 3 по юж1пслыю

конгрои.- К n. tvpa рк- 15 2 отрииатечьно 2 отрииатечьно

да iee в комиссионных опытах от евннен из новосибирской об т. красноярского края и хакаской республики подозреваемых в заболевании кчс при исследовании одного и того же биоматернала от свинси с помотныо от-пцр и кучьтуры клеток рк-15 в рпи на 47 биообразцах быча подтверждена специфичность разработанной тест-системы rst-маркирования вируса кчс было опреде тепо, что при генетическом маркировании мрнк вируса кчс в консервативной в области, котирмотцеп бечки-предтнеетвенники гликопротсина gp44/48 с помопгыо проб на 27 бочьше, чем при испочьзовапии ку чьгуры к геюк

при маркировании мрпк вируса вд крс (рис 2) праимср л»1гсу исттотьзовалн д 1я сшпеи первой цепи кднк, комплементарной вирусной рнк вд крс, в реакции обратной транскрипции а нтькипи праймер — 4атр1 в но шмеразпои реакции дчя синтеза второй цепи кднк затем оба праимера

4лпр1 539;-ggaagggatacaacgggc-j39;

madl igggacggaagggatacaacgggcaat1254

bdl a 1254

oregon а 12 54

stp9u с с a g I5 t 1251

1slos3 а с 1251

lie ь 39; -cccagccagaccttagat- j 39;

hadl taccagggtcggtctggaatctaggapat

hadl taccagggtcggtctggaatctaggapat 22 3?

sd1 t 2238

oregon t 2238

st890 д a g с g g 2238

c8loss t at t 0 223 f

рис 2 — участки выравненных нуклеотидных последовательностей вируса вд крс, имеющих наибольшее сходство

испольюва 1и тля амплификации участка тенома вируса в иолнмеразнои ценной реакции анализ считали положнтечьным, если протуктпцр соответствовал ожидаемому рлзмерч фрагмента в 997 нуклеотидпые пары результаты, проведенных экспериментов показали, что но юл-стие тытые анаитзы продуктов гщр полу чаш тотько тогда когда в качестве матрицы использовали кднк вируса вирусной тиареи анализы были отрицательными, когда использовали кдик вируса ктассическои чумы евинеи

сконструированные маркерные системы с помощью от-г1цр обладают высокой специфичностью сокращают время нсслечозания биотоптческнч образцов с 192 часов на м н. т ре к теток до 28-30 часов

2 2 2 2 si ss-мартснровлнне нукчеотн iin, i после товдте тт. Ностен fusob. Ictci nun neerophoi um

2 2 2.2.1. выделение суммарной днк f iiecropliorum из биообразцов с использованием нротенпазы к (10 мг/мл) и 10 став

нами разработаны гье мо тифнкацнп по вычел. Чтию геномной днк rusobacierium nectophorum в первой — основная ипрогениизания днк rusobdcteiium доститается обработкой нротенназои к при ¦4-55°с в течение 18-20 часов с постечующсн дополните тыюи обработкой фено т- юроформеннои смссыо п осажтенисм этанотом (рис!) Во второй — основная тенротстиш зацпя днк осмцсствпяется обработкой 10 с гв при 180ес в течение 1,5 часов с нос телу ющен юно пште пgt; пои обработкой фенол-хлорос] орменнон смесыо и осаж тенисм этанотом д тя качественной оценки выделенной днк проводили рестрикцию ферментами 1 corl akil, llindlll llaclll, bamlll, sali xbal, mspi

затем j гекчрофорез в 1 агарозе с нанесением

затем j гекчрофорез в 1 агарозе с нанесением в; карман; 5 мкл гнчро нтзованнои днк вт. Ие тение считали у довтетворшемтытым носкочт. Ку пашвная днк быта

видна в виде полосы, а после гидролиза эндйнуклеазами ecorl. A lui. I lindlll, i laelll — ii виде нескольких фра! Ментов разной длины.

рис, 3. — геномная д1ж f. пес гор ho ru m шт. «чнк-1020», выделенная с помощью протеиназы к ( 10 мг/мл); m -маркер плаз ми да puc18 гидролизованная alui;

! — днк f. necrophorum, внесено в «карман» 5 мкл; 2 — днк f. necrophorum, внесено в «карман» 3 мкл

i ?роверка чистоты выделенной днк, проверку качества выделения дм к по двум вышеописанный методикам осу пест идя л и по маниатис т. фрич э„ с) мору к д. (1984). делали два замера плотности раствора днк пробы на спектрофотометре марки сф-26 при длине волн: ш60 им и 13280 им. Если соотношение величин плотности 0260/0280 равно 1,8. то это показатель свободной от белков выделенной днк. При использовании

модифицированных нами методик получали соотношение величин плотности раствора днк 1)260/0280 равное 1.74-1.75.

2. 2, 2.2.2. конструирование полимеразион цепной реакции для выявлении fu sob а с te riu ru necrophoriim

1 iph разработке маркерной тест-системы столкнулись с тем, что в отечественной литературе мы не нашли описания ии одного референтного штамма ?5йзных подвидов f uso bacterium necrophpnim. На что указывали в своих работах р. и. соломаха, л. в. кирилов. Н. н. кружков, Маркировать инструкции и24-18-197-89, е. г. лавченко, з. м межнева (2000). поэтому экспериментальные исследования проводили, ос новы в а яйь на данных по последовательности l39; usobactcrium miclealum subsp. Nucleatum шт. А тсс 25586. 1 la м и были синтезированы несколько пар прайм еров к нуклеотидным л ос ледо вателъноетям повторов (транспозонои|) в разных областях генома: tr 1001088- 1002569. tr 1443345 — 1443968, tr 369003 — 370178, tr 483480 -484138 и tr 896181 — 896900, которые прилегают к нескольким генам кодирующих гемолизин. I доведенные разведочные 11цр показали перспективность области tr 483480 — 484138 и эти результаты согласуются с исследованиями a.

l. m. hodgson, l. a. nicholson, tj. Doran

l. m. hodgson, l. a. nicholson, tj. Doran. L. a. corner (1993).

с учетом опубликованных данных но секвенированию отдельны

фрагментов днкг fuso bacterium necrophorum были вы бра. И синтезированы

прапмеры в области, характерной для вирулентных штаммов fusobacterium, которая отсутствует в сопутствующей микрофлоре, такой как стафилококки, стрептококки, микрококки, кишечная палочка, 11 рай мер 1 i и 12 для синтеза с помощью фермента tag-полимеразы, фрагмента в 558 нп геномной днк в

полимеразпой цепной реакции. Внутри рнигеь.39; Ро. Чаиного фрагмента был заила-пиронац сайт рестрикции мi, но которому нарабощнный фрагмент после [ идро. Тнча должен образовать два меньших фрагмента в 197 и 358 нгт,

с помощью (наружных) праймеров 1! и 22 в пцр синтезировали фрагмент и 55к ни. Ил матрще днк кульг. Ры ?. ж39; огорьогчт «чик-!020|, оаиак« при постановке iii [i1 с наружными праймерами полоса синтезированного фрагмента днк; в геле 1 агарозы была очень слабой. В то же время общее количество суммарной дик микроорганизмов. Выделяемых из проб патологического материала было значн тельным. Это свидетельствовало о большом примеси д1 ! к сопутствующей микрофлоры п о малом содержании в образце днк i;. песгорйошт. 11Отгому после синтеза, клонирования и секвеппроиаппя фрагмента д11к культуры «чнк-1020» сиитезишвйл внутренние (гнездовые) пранмеры: 01] и 022. их йшользонали для усиления положительного сигнала при проведении реамп.

тифишшп, с помощью прайм еров 01 i и

тифишшп, с помощью прайм еров 01 i и 022 синтезировали фрагмент внутри первого и 289 и. п.

i ! ри проведении испытании гест-системы на специфичность выделили днк из культур микроорганизмов (рис. -I в табл. 2), Наиболее часто встречающихся при

4. ж. 6 7

si 9 юм ii

рис, 4. — результат ы проверки па специфичность праймеров 1 i и 22; 1 — e. eoli; 2- ?. сой j и103; 3- str. Pyogenes; 4- prot, vulgaris; 5- bac. Subtilis; g- si. Aureus; 7-1. necroph. M5/1; 8- г. necroph. M5/2; 9- v. necroph. M5/3: gt;0- !¦;. necroph. «чикgt; gt; 1 i-дисти лд вода. М- puci8/alul

кекробактериозных поражениях, а также имеющих схожую клиническую картину: staphylococcus aureus. Staphylococcus album, streptococcus pyogenes, streptococcus epidermitis, escherihia coli, saimonela dublin, proteus vulgaris.

таблица 2, результаты исследований на специфичность, прайме ров тест-системы

к». П/п наименование культуры пцр с п ран мерами

наружные внутренние

1 staphylococcus aureus отрицательно отрицательно

2 staphylococcus albus отрицательно отрицательно

3 streptococcus pyogenes отрицательно отрицательно

streptococcus eptderfnims отрицательно отрицательно

5 escherihia coli отрицательно отрицательно

6 salmonella dublin отрицательно отрицательно

7 proteus vulgaris отрицательно отрицательно

к «чик-1020»» гпу извсидв положительно положительно

9 i-. necrophorum. Виэв-j отрицательно положительно

к) f, necrophorum, виэв-2 отрицательно i !

оложительно

оложительно

n f. necrophorum, гну иэвсидв отрпцател ьно положительно

12 дистиллированная вода отрицательно отрицательно

для дополнительной проверки специфичности гнездовой iiii!39; Осуществили идентификацию культуры «чик-1020» гну иэвсндв, Маркировать инструкции и24-18-197-89, отнесенного к ?. пеегариошт с помощью пдрф-пцр анализа (рис. 5). С этой целью провели гидролиз большего фрагмента эпдонуклсачой мр| и получили генетический профиль (паттерн), состоящий из двух фрагментов длиной и 359 и. п. и ют н. п. 11ослс

рие.5. Гидролиз ам л ли кона эндонуклеазой mspl: м — плазмида puc18, гидролизованная alul (маркер).

1. продукт амплификации изоляiа; чшс;

2. продукт гидролиза ам пли ко на mspl

гидролиза внутреннего фрагмента днк в 289 н. п. получали генетический профиль (паттерн), состоящий из двух фрагментов длиной в 121 н. п. н 178 н. п. размеры этих фрагментов совпадали с ожидаемыми. На основании вышеизложенного можно заключить, что фрагмент, синтезируемый па матрице днк культуры f. necrophorum

«чик-1020» гну иэвсидв по последоватедытосгп обеич пар праимеров (наружных и виу ipennnx) п местоположению сайта рестрикции можно отнести к вирулентному подвиду г neciophorum subsp пссгор1тогит далее провели опреде юние пукпеотидпои последовательности по двум цепочкам днк, иснолыуя общепринятую методику максама-гилберта при сравнении фрагмента днк ку тьтуры «чик-1020» i ну нэвсидв (ay241175 gi 31087943) с последовательностью дик hit fnsi установили что они совпадают с последовательностью шт fnsi г necrophorum subsp necrophorum за исключением одной дсчецин g в позиции 15 и двух вставок соответственно л и g в позициях 441 и 538 нп чувствительность разработанного способа гнездевой пцр для диагностики некробактериоза составида 12,0 пг/мкл суммарной днк

было обращено внимание на то, что практически

было обращено внимание на то, что практически в большинстве случаев фрагмент днк fusobacterium necrophorum, где были животные с хроническим инфицированием, визуализируется только после использования двух пар праймеров наружных и внутренних исключение составляли случаи после острого заболевания некробактериозом (без медикаментозного вмешательства), при которых после проведения пцр с наружными праймерами визуализировался больший фрагмент однако после нескольких пассажей на печеночной среде культуры fusobacterium утрачивали это качество и визуализировались только после проведения дополнительно пцр с внутренними праймерами это ориентировало на малое число копий тестируемого фрагмента в полной последовательности днк fusobacterium necrophorum

2 2 2 2 3 совмещенная гнездовая иолимеразиая цепная реакция (two in one nested pcr) для выявления rniroi еипых fusobacterium nccropboruni

по пшеразную цепную реакцию проводили в два этапа в объеме 25,0 мкт

первый паи — пцр с наружными праймерами проводили аналогично, чю и при раз тельном проведении гнездовой реакции при следующем режиме прогревание реакционной смеси при 95°с в течение 3 мин — 1 цикл затем денатурация при 94°с — 0 3 мин, отжиг — при 5б°с — 0 4 мин и синтез — при 72°с —

0 6 мни — 30 цикдов далее один цикл — пауза 5,0 мни при 72°

в юрой нап — во время паузы в 5 мин в каждую пробирку вносит по 3,0 мкл смеси второй пары праймеров 011-022 амплификацию продолжали при температуре отжига 60°с с помощью наружных праимеров 11 и 22 синтезировали фрагмент в 558 и п, а с помощью внутренних праимеров 011 и 022 -фрл1меш внмри первою в 289 н п

результаты исследовании учитывали по наличию специфических фрагментов днк в подожительном контроле размером в 558 н п или в 289 н п исследуемые пробы счшапи отрицательными, если в них не быдо выявдено никаких полос, иди полосы не соответствуют по размеру фрат менту в контрольной пробе документирование поименных результатов проводили с помощью цифровой фотокамеры

совмещенное проведение гнездовой пцр но

совмещенное проведение гнездовой пцр но выявлению naioieniibix

1 usobactenum neuophoium позволило сократить время выделения геномной днк при использовании 10 став с 22ч до 5ч снизить стоимость выдепения в 3 раза, сократить время проведения реакции на 2 5 часа и сэкономить реакшвы на проведение 50 реакций пцр

2.2.2, 2. 4. мулыиилбксиая полнмеразная цепная реакция для ген отпирован и я культур fusobaeterium пес гор h и г um

одним из немногих признаков, Маркировать инструкции и24-18-197-89, позволяющих дифференцировать подвиды fusobaeterium пес го pli о rum, является способность f. n. subspecies necrophorum агглютинировать эритроциты птиц (t. shinjo, к. hiraiwa and s. miyazato, 1990; t. shinjo, t. fiijisawa and s. miyazato, 1991; l. a. nicholson, c. j. morrow, l. a. corner and l. m. hodgson, 1994; z. l. tan, t. g. nagaraja and m. m. chengappa, 1994; о. и. солом axa, j], в. кирилов. H. m, кружков и др. 2000).

достоверным критерием по выявлению fusobaeterium necrophorum и разграничению их на подвиды будет определение у них общих генов и гена гемаплютинина с помощью мультиплексной одношаговой пцр, в реакции в объеме 25 мкл при температуре отжига в 56°с использовали в одном варианте одновременно три пары праймеров: 210-220, 180-191 и 2i5-2i6gn (рис. 6, 7). В другом варианте в реакции участвовали две пары праймеров: 17-19 и ?80-191.

1 2 3 4 5 6 7 8 9 (0 11 12 13 14

i4ic. Ii.- Генотип к рование культур fusobaeterium nccroplwrum с помощью мультиплексной пцр по трем генам: протеина оболочки, днк-гиразы, гемагглютинина: -л i — 1. 2 — 2. 3 — 3, 4-4, 5 — 5, 6 — 8. 7 — 9, 8 — к-. 9 — 12. ю- 13, 11- 15,12 — staf. Aureus, 13 -strepi.

albus. 14- Ii. Coli (фрагмент исследований

albus. 14- Ii. Coli (фрагмент исследований)

36 37 38 39 4« 41 42 43 44 к- m

рис.7.- Генотипирование

культур fusobaeterium с помощью пцр по трем генам: протеина оболочки,

гемагглютинина. Днк-гиразы; 36 — 4км, 37 — 2в, Маркировать инструкции и24-18-197-89, 38 -м2, 39 — 7кр. 40 — 5Р, 41 -6р, 42-юал, 43 — 11 чк, 44 — 12кр, к- дистилл, вода, м puc18/alul. (Фрагмент исследований)

анализ считали положительным, если размеры амтикопов

соответствовали соответственно в 906, 645, 370 и 645 228 и п маркером служила днк pqpr, гидролпзованная иаеш далее провели генотиппрованне культур rusobacteuum necrophorum с целью их идентификации с помощью мулытш текепои одпошаювои пцр по ipei lenam — -но ieiiu белка оболочки (гров), фермента днк-гпразы (dna gyrase в ) и гемагпнотпнина (omph) и одной межгеннон вставки (16s-23s лсйкотоксина) для сравнения использовали днк, выделенные из баыерии штаммов staphylococcus aureus, streptococcus pyogenes и escherichia coll резудыаш бычн гюлолсшелыгыми, если днк кулыуры относилась к виду hisobacteriuin necrophorum, и были огриц гтелытыми, если днк было выделено из сопутствующей микрофлоры

для подтверждения специфичности тестируемых тепов бедка ободочки (тров), фермента днк-птразы (dna gyrase в protein), ген гемагтлюгннина (ompll) и спспсср 16s-23s лейкотоксииа мы ттаработали ати фрагменты на матрице днк соответствующих культур 8(8ts630501) 12( 12tsk630501 и 27 (27tsm630501) и провели секвенирование

анализ нуклеогнчных последовательностей синтезируемых фрагментов проводили методами выравнивания с другими опубликованными нос тедоватечьностями усыновили, что рассматриваемая нуклеотидная нос тедотзателыюсть вставки 16s-23s лейкошкеина изоляа 8(81 s630501) совпадала с нукчеогиднон после ювательтюстью культур л; 12 (12 isk630501) и 27 (27tsm630501) и штаммов гп subsp necrophoium гп 48 (аг410959) и icm3716 (лг410965) и гп subsp lundulilorme гп 513 (лг410961) и jcm3717 (аь410967)

определили, что нуклеотидная и аминокислотная

определили, что нуклеотидная и аминокислотная последовательности гена гров ку тыуры 8(8ts630501) совпадают соотвественно с последовательностями кулыур 12 (12tsk630501), 27 (27tsm630501) и штаммов гп subsp neciophorum а i сс 25286 (а1-527637) и на 30 с i п subsp tundulifoime тпг а гсс 51357 в районе 339; — кошта

нуклеотидная и аминокислотная нос юдоватсльности исследуемою фрат мента гена omph (т ен гемат i дютитшна) кльтуры 8(8ть630501) совпадает с пос 1словагечыюстыо культур 12 (12fsk630501), 27 (27 1 sm630501) и штамма и 1 n subsp necrophoium at сс 28256

нуклеотидная и аминокислотная последовательности исстедуемого фрагмента тена фермента днк-гиразы (dna gyrase в prolem topoisomerase ii) культуры 8(87s630s01) совпадали соотвсственно с последователытостямтг штаммов f n subsp neciophoium nctc10576 (ay372007), inl (ay370663) и 1 n subsp iunduhlorme гп45 (ay370665), а ыкже с иоследовагечыгосгями кулыур 12 (121 sk630501) и 27 (27 tsm630501) из полученньк гапных с тедуег, ч39; ю шффереицирующнм признаком межд 1 n subsp necrophoium и 1 n subsp fundulifoime является ген iемагглютинина имеющийся только у гп subsp neciophorum

1 аклм образом на основании атмдтма результатов исследований, впервые в рф сконструирован вариант му ндлтлексноп одношаговои полтгмеразной цепной реакции пригодной для reiroiннировапия выделенных кугыр rusobacteuum necrophoium эта реакция обладаем специфичностью, гак как согласуется с г не повой пцр и высокой чувствительностью в 10 пг/мкл

2 2 2 2 5 идентификация и депонирование штаммов fusobactcrium necrophorum subsp necrophorum

в процессе исследования культур fusobactenum

в процессе исследования культур fusobactenum necrophorum, выделенных от больных животных в разных регионах российской федерации, согласно «методический указаниям по лабораторной диагностике некробактериоза (утвержд гув госагропрома ссср, 1987), было отмечено следующее с увеличением числа проведенных пассажей на питательных средах количество положительно реагирующих в гнездовой и мультиплексных пцр уменьшалось (от 3-го к 23-му пассажу) и далее стабилизировалось так, из 40 культур из приволжского региона в начале исследований 4 культуры, не-/смотря на морфологическое сходство с fusobactenum и патогенность для белых мышей, по результатам пцр были отрицательны в последующем с увеличением числа пассажей их стало больше копичество положительно реагирующих стабилизировалось на 10 культурах аналогичную картину наблюдали и с культурами, выделенными в западно-сибирском регионе, где из 7 положительных культур в начале исследований, осталось стабильно положительными 2

мы полагаем, что при проведении диагностических исследований согласно «методическим указаниям по лабораторной диагностике некробактериоза (утвержд гув госагропрома ссср, 1987) наряду с fusobactenum necrophorum выделяются и не идентифицированные (uncultured) fusobactenum, а также fusobactenum pseudonecrophorum и другие анаэробы, морфологически схожие с f necrophorum, но обладающие несколько большей энергией роста доля чистых культур при этом способе составляет около 30 (т е около одной трети от всех выделенных анаэробов) об этом сообщали и зарубежные исследователи tajima к. arai s. ogata к. nagamme т. matsui н. namakura м. aminov r i and benno y (2000)

по результатам генотипирования культур

по результатам генотипирования культур выбраны две как наиболее характерные представители fusobactenum necrophorum subsp necrophorum штамма штамм 8(8ts630501) и штамм 12 (12tsk630501) принадлежность, которых к подвиду necrophorum подтверждена установлением нуклеотидной последовательности генов транспозона, белка оболочки, топоизомеразыи (днк-гираза), гемагглютинина и межгенной вставки (16s-23s лейкотоксина) нуклеотидные последовательности амплифицированных фрагментов приведены в genbank/ncibi locus dq417656 [gi 89891991] (днк-гираза, топоизомераза и), dq417657 [gi 89891993] (спейсер), dq335667[gi 84872488] (белок оболочки) и dq341278[gi 85002770] (гемагглютинин) эти два штамма были депонированы по заявке двух институтов гну иэвсидв со расхн и вниви (г казань) в нии «коллекции культур микроорганизмов» фгуп гнц вб «вектор» fusobactenum necrophorum subsp necrophorum штамм 8(8ts630501) 1705/b-1075 от 8 сентября 2005 г и fusobactenum necrophorum subsp necrophorum штамм 12 (12tsk630501) 1895/ b-1076 от 8 сентября 2005 г данные штаммы fusobactenum necrophorum subsp necrophorum могут быть использованы при разработке диагностических систем и генетическом маркировании изолятов fusobactenum necrophorum

2.2 2 2 6 изучение геномного полиморфизма культур rusobacteilinn necrophorum с помощью rapd-пцр

в настоящее время широкое распространение получила технология полимерашоп цепной реакции (пцр) для выявления генетическою

по шчорфизмау разных групп ор1анпзмов она широко испотьзусгся с коро1кмчп с 10-15 ни праймерачи со «с туманной», произвольно выбранной последовательностью — rapd-анализ (iadon amplified polymorphic dna)(c а булаг, о к кобаев, Маркировать инструкции и24-18-197-89, 11 в мироненко, ф м ибатулин л а лучкина, л в суслов 1902, ил шатпнян, л л гинцбурт, 1995, igk williams mk папагеу, ia rafalski, s v fingey, 1993) метол rapd-чарксров позволяет получать боты нос число маркеров, Маркировать инструкции и24-18-197-89, рассеянных по всему геному, поэтому такие маркеры удобны для построения генетических карг (10 п алтухов е а салчепкова, 2002, и а шатиняп, ал гинцбур. 1991 Cp joshi, 111 nguyen, 1993, j (, к williams, m к hanafey, j a raialski, s v tingey, 1993) )

при анализе дпк-паттериов, Маркировать инструкции и24-18-197-89, для установления

при анализе дпк-паттериов, Маркировать инструкции и24-18-197-89, для установления уровней родства очень важен выбор о нпопук теотидныч нрайчеров, Маркировать инструкции и24-18-197-89, которые давали бы наибо iee информативные картины теномното полиморфизма f necrophorum из проанализированных 50 олигонуклеотидов были выбраны и синтезированы следующие десятинуклеотидиые праичеры 13, 16, 18, 20, 21, 023, 0023, 27, 28, 36, 38, 44, 48, 50 после осуществления мцр и сравнения полученных паттернов, Маркировать инструкции и24-18-197-89, выявили, что не всс сконструированные нами праймеры были пригодны для внутривидовой дифференциации изолятов г necrophoium малоинфорчативиычи оказались опшонуклеотды 16, 18, 20, 21, 0023, 28, 36, 44, 48, 50 результат геногипнроваппя с оставшимися пранмерачи приведены в таблице 3

таб ища 3 значения величии индексов подобия при попарном сравнении базовых культур с пзолятами 1- песгорьогштт в запдлной сибири

1сgt; лы39; рм ксчеров об п виэв новосибирская область . | 1.1111. к кран i омск обл

i кеч 215 3 м21 4 кр | 5 р | 6р 7 л ii 8 1с

праичер 13

3 412 0 61 0 75 — 071 0 57 0 57 0,47 lit ikcli i

2 ни jb-i 0,87 — 0 75 0x0 0,63 0 86 0 46 11l liel. Ilt; _ 1

(gt; р 0 67 0,80 0 67 0 77 04 — 0 38 не ncciei

прлйчср. V» 023

3 м2 0 то 0 55 — 0 62 0 1 3 0 40 0 20 hc llectcj

6р 0 15 0 44 0 60 | ii 36 0 57 — 0 50 lit ikc 1ch

пранмер „м1 27

3 м2 0 50 0 20 — 0 77 0 20 0,22 0 25 he ncuic i

2 в1п13л 0 50 — 0 60 0 44 0 33 0 60 0 50 hi. Iicc ti. 1

(» [39; 0,29 0 40 0 44 0 25 08 — 0 67 he net. Iu1

праичер

праичер 38

3 м2 0 86 0 42 0 77 0,40 0 92 0 92 —

2 вт! Л!-1 0lt; л — 1 00 0 92 0 50 0 01 0 78 0 48

6 р 0 so 0 86 0 42 0 71 0 59 — 0 71 0

анализ величин индексов подобия при попарном сравнении изо тягов относящихся к патогенному виду fusubactenum necrophoium, показа!,

что наиболее пригодным для ген оптирования был лраймер зу, проведений генотипировапие с помощью «произвольных олитнуклеотндов.

прайм црующих геномную док н. песгорьошт выявило высокую степень гомолог ни всех изолятоа со штаммам 28 (виэв), кроме изолята раздольное лг,.39;5 и — из свинокомплекса, где индекс схожес ти был низким и составил 0,50. при попарном сравнении днк изолятов культуры 3

м2(иэвсндв) с д1 ! к культуры 6 также была выявлена низкая степень подобия 0,40 и 0,59 с культурой 5. следовательно, в хозяйстве «раздольное» нсо выявлена циркуляция двух вариантов патогенных г. песгорьогшп, которые морфологически схожи. Культура й более патогенен для белых мышеи, чем культура 5.

был получен спектр паттернов при проведении ил 139;10-1 11 и1 с помощью нраймерд 38 и проведен их анализ днк культур г. песторьогит, выделенных от животных разных регионов западно-сибирского округа ?рис. 8). Для распределения изучаемых изолятов г. песгориогшп по группам связанных с общностью их

1 2 3 4 5 6 7 8 9 10 1112 м

рис.8. — Rapd-пцр анализ днк f. necrophorum, выделенных от животных западно-сибирского округа с помощью иранмера 38: i -str. Epidermity, 2 — staf. Album, 3 — e. coli, 4 — [жр. Культура 3 пассаж, 5-8чик, 6 — 7ллт. 7 — 6Р. 8 — 5р. 9 — 4кр. Культура i пассаж, 10 — 3 м2 (иэвспдв), 11 — 2в (виэв-1), 12 — 1 кем. М — маркер

происхождения был проведен кластерный анализ

происхождения был проведен кластерный анализ полученных паттернов. Генетические связи между культурами fusobacterium necrophorum, выделенных из разных регионов западно-сибирского округа изображены на денлрограмме (рис»), построенной па основании rлрd изменчивости, выявляемой с использованием праймера 38. кластерный анализ разделил изучаемые культуры на два кластера, в один кластер, отмеченный малой стрелкой, с двумя субкластерами вошли четыре культуры fusobacterium necrophorum: 3 м2(иэвсндв), 5р, 6р и 7алт, из них наиболее генетически схожими были 5р и 7алт. К ним примыкает культура 6р. отдельной ветвью стоит культура 3. в другом кластере, отмеченный большой стрелкой, объединены пять культур fusobacterium

365721489

рис. 9. — Дендрограмма распределения культур р песгор1тогит, выделенных от животных западно-сибирского региона по результатам кластерного анализа по вертикали показаны генетические дистанции, а по горизонтали даны номера изолятов 1-1кем, 2 — 2в (виэв), 3 — м2 (иэвсидв), 4 — 4кр культура 1-й пассаж, 5 — 5р. б — 6р. 7 — 7 алт, 8 — 8чик, 9 -4кр культура 3-й пассаж культуры 4к

пеиорьошт 1 кем. 2В (виэв), 4кр. 8 Чик, 9кр культура 3 пассаж наибольшее генетическое сходство проявнчи культуры 1кем, 4кр а затем культуры 8чик и 9кр 3 пассаж неско тько отдельной не! Выо сюит культура 213 (ви )в) проверенные псстедования показали возможность выявляй, генетические связи между различными культурами г песгорьогит установлена циркуляция в одном хозяйстве двух вариантов патотеннои г песгорьошпт 5р и 6р, которые тенетически разно удаленных как но отношению к культурам 1кем и 4кр) так и к культурам 3 м2 (i ну иэвсидв) и 2в (виэв)

при тестировании культур из привопжского

при тестировании культур из привопжского региона испочьзовали ранее апробированный «произвольный» праймер 38 539;-дсддсдддсс-339; результаты сравнения полученных днк-паттернов (табч 4) позволили разделить про гсс тированные ттзоляты по уровню схожее i и к нук1согиднои нос тедователыюсти культуры 3430 на три iруины одна из них (11 из 36) с высоким уровнем схожести от 0,73 до 0,90, чрутая группа (6 нз 36) со средним уровнем почобия от 0,53 до 0,73 и третья группа (18 из 36) с очень низким уровнем схожести от 0 13 до 0,53 из пи данных следует что, на территории округа циркулируют культуры р песторьогштт с различным уровнем юмоютии, тде низкий уровень схожести среди них занимает значительное место по результатам ядро-ицр провели кластерный анализ для распределения изучаемых культур гтьоьастепит песгорьогит по тру пнам связанных с общностью их происхождения i енетические связи между кулыурами г песгорьогит, вы деленных из разных регионов приволжского округа, изображены на дендрограмме (рис 10) она построена на основании каро изменчивости, тзыяв тяемой с использованием праймера 38

таблица 4 значения ветчин индексов подобия при попарном сравнении кулыур i neciophorum, выделенных в приво тжеком регионе

примечание «ьgt; — по юани, тьныи резу тыа[

n п. шмспоплп iipoollj lwn. Ivpil выпилите in iiiuhhoii. I уровень 1 омо ioi mi n пробы il.

liimliionjii н ugt; » pi 1 hi. I

liimliionjii н ugt; » pi 1 hi. I39;. iii leiiue ip шсшнонл уровень 1 01(l 1011111

xickhoulk. Go 1ki! (Hi hkti) 1 ill apci iii

2 | 3430 | 1- | 1 00 3 с пм + 0 73

11иисхкс 4 л t 0 s3

1. s9 4 | — | 0 s3 5 111 r 0 13

ни лз 10 с-(gt; ) 0,13

213 | hit)!3-l — | 0 40 1 1 дц. 0 13

( ар и okl к i; i об uci i 12 в к l 0 13

8 | к | t | oftl 13 ||14| i 0 88

ь нпкарнк тан 14 1ч lit bi. Uisuui 0 88

ч | 1 l. tii | г | 0,13 и л,1-14 0 13

марии 39;) 1 16 1-12 + 0 13

20 мню о х;, 17 то 1 1 0 80

27 м11ю-2 0,13 18 ус11 0 13

с 1м ф39;-ь ш об йен 40 111 а к 0 13

0 с к к 0 40 ульяновская об ?аиь

7 1907 — 0 88 23 увр | + 0,67

21 ( 1 -г 0,73 24 кг | + 0 t 3

22 искра he иыяи 1ui 0 73 25 с киям t 0 36

у imvpnni 34 умм + 0 78

i;1 р1 о п

33 р-4 0 п

14 м(ък lit hi imbijwi 0 78

ктастерпыи анализ разделил изучаемые кулыуры на три кластера (рис 10) один из них срсднии включал два субкластера наиболее разнородный среднип к lacrcp (одна короткая стрелка), объединяющий кулыуры, выделенные в ульяновской об не in (24,25,39), республиках мари эл (27,28,29,30), у тм ртег ой (-32, 33) и р 1 агаре тане ( 5, 10, 11, 12, 14, 15, 16, 18 36, 38) слсдег огчетпгь в этой группе два субкластсра в один входят 35 и 40 (р татарстан) а в друiой — 3 и 25 (соогвссгвенно республика татарстан и ульяновская область) от тельной ветвыо слоит культура 4 (р 1агарсган) во второи кластер (две короткие стрелки) вошли культуры 7, 21, 22 (самарской обл), 13,14, и 17 (р татарстан), gt;23 (ульяновская обл ) и 1 (11иисх краннето севера) в греши кластер отмеченный длинной стрелкой входят две куп, туры имеющие от тленные т енсл ичеекпе связи с культурами двух ару тих кластеров это ку тьгура 6 (самарская обл ) и 2 (московская обл )

гч

гч 1

jjl i jl fi? Х,

6 40 39 37 33 31 29 27 24 18 15 ii 9 5 25 23 22 7 20 1 2 35 38 36 32 30 28 26 19 16 12 10 8 4 3 17 13 21 14

рис. 10. — Дендрограмма распределения культур f. neerophprum выделенных и приволжском регионе по результатам кластерного анализа rapd-пцр с праймером 38. но горизонтали даны номера нзолятов, Маркировать инструкции и24-18-197-89, по вертикали — генетические дистанции.

исследования полиморфизма ди1с культур f. necrophorum выявили неоднородность их популяции. Далее нами были испытаны в rapd-iiu. P еще несколько произвольных праймеров: с 55 по 65. эти праймеры были выбраны на основании анализа ну клеотидиых последовательностей генов, Маркировать инструкции и24-18-197-89, кодирующих белок оболочки, а 38/1 — белок лейкото ксина. 11Аиболее информативными оказались праймеры 3839;1 и 60 в паре с o 1.

при анализе rapd — спектров, Маркировать инструкции и24-18-197-89, полученных с помощью праймера 38/1 51 -gcggcgga-. u 339; были выявлены характерные для большинства исследуемых и юля гон фрагменты. Методом кластерного анализа были определены генетические расстояния между изолятами. На дендро: рамме (рис, i 1) выделяются два основных кластера: в первый входят и золя ты 9, 8, i 2, 2. 19и 16; во второй — 41, 2в н 40. и отдельные кластеры вхолят 20, 22. 34.

при проведении rapd-аналнза одновременно с пранмерами 60 и 61 (рис.12) Соответственно 539;-gcttatggtgc-339; и 539;-gcatatggggc-339; выбранными но нукпеотндиым последовательностям белка оболочки, были определены расстояния связывания кластеров среди исследуемых культур. На дендрограмме выделяются два основных кластера: в первый входят и зол ять 19; 2, 41, 17 и 1; во второй — 8, 27. 12 и 13. в отдельные кластеры входят 34 и 37.

каждый из основных кластеров (рпс.11) Представляет

каждый из основных кластеров (рпс.11) Представляет собой смешанную группу. Так степень сходства (праймер 38/1) между основными кластерами находится на уровне 0,42-0,54, что ориентирует на значительный полиморфизм между изолятами данной выборки но патогенности, у двух основных кластеров (рис. 12) Полученных с

20 34 41 2в 40 22 9 8 12 2 19 16

рис 11. — дспдрограмма 12 изолятов rusobactcrium nectophorum, построенная по резу чматач rapd-апачиза с прапмероч 38/1 по торизонталп номера культур, по вертикали тенетические дистанции

34 37 8 27 13 12 19 2 41 17 1

рис 12 — дспдрограмма 11 культур fusobactermm necrophorum по резу лыатач rapd-анали за с прапмерачи 60-61 по i ори зон тали — номера п зотятоп по вертикали — теистические дистанции

помощью праимеров 60-61 уровень сходства составляет 0,45-0,63 так как тги прайчеры бы пи выбраны на основании пуютеотндных последовательностей, кодирующих белки оболочки, а у ана фобов разных видов они выпошякм в основном одни и те ас функции, то и сходство межд изолятачи основных кластеров несколько выше эксперименты на белых мышах с этими культурами выявили различное воздействие на животных сукон некроз подкожных тканей ити паралич конечностей, или похудание при параличе задних конечностей 1о

ecib исследуемая ipynna изотятов данного вида микроорганизмов оказалась разнородной, несмотря на морфологическое сходство

проведенное маркирование с помощью rapd-пцр и использование произвольных нраимеров сконструированных на основе нуктеогидпои пос юдовательносш деикоюксина — 38/1 и протеина — 60-61 rusobacterium neciophorum более полно отражают степень схожести культур из разных территории в сравнении с результатами морфологических и биологических исследовании высокие показатели полиморфизма внутривидовых генетических дистанций свидетельствуют о значительной т енегической неоднородности популяций исследованного вида fusobacterium necrophorum отобранные маркеры можно использовать по маркированию дик и паспортизации культур г necrophorum, а также moiyr помочь в опреде тении закономерностей появления и циркуляции тин3001 ическнх штаммов в стадах, выявлять изменчивость микроорганизмов пот воздействием различных факторов

2 2 2 2 7 исследование белкового полиморфизма культур rusobacteiiuin necrophoium круиного рогатого скота

в нашей стране и за рубежом поиск специфических

в нашей стране и за рубежом поиск специфических препаратов в виде вакцин и гипериммунных сывороток не принес ожидаемых результатов ас донченко, а а самоловов (1998) высказали мнение, что создание при некробактериозе высокоэффективных вакцин традиционными методами маловероятно в неудачах, которые долгое время сопутствовали работам по созданию специфических средств профилактики некробактериоза имело немаловажное значение игнорирование авторами неоднородности циркулирующих в природе эпизоотических штаммов fusobacterium necrophorum

из полученных данных морфологических и биологических исследований свойств изолятов fusobacterium necrophorum заключили, что изучаемые культуры представляют достаточно однородную группу микроорганизмов являются неподвижными грамотрицательными бактериями, располагаются в поле зрения в виде палочек или нитей разной длины со слабой или сильной зернистостью согласно данных литературы длинные нити, палочки образуют не только f necrophorum, но и культуры f godiaformans, f mortiferum, f necrogenes, f periodonticum, выделяемые от животных

fusobacterium necrophorum морфологически также схож с родом bacteroides, культуры которых можно выделить из пищеварительного тракта (слепая кишка, рубец) для подтверждения однородности в антигенном отношении изучаемых изолятов fusobacterium necrophorum провели биологические пробы на белых мышах

несмотря на схожесть изучаемых культур по морфологическим и культуральным свойствам, при проведении биологической пробы на белых мышах клиническое проявление заболевания и картины посмертного вскрытия были разнообразными это ориентировало нас на полиморфизм белков у этих культур

при изучении полиморфизма белков культур

при изучении полиморфизма белков культур f necrophorum базовыми культурами, с которыми мы сравнивали остальные, были 8, 12 и 27, которые нами идентифицированы и 34 не идентифицирован из анализа паттернов следует, что наибольшее сходство отмечали у 8, 12 и 27, а расхождение с 16, 22, 24, 34 и 40 особенно отличалась от других культура 34, которая не идентифицировалась при проведении пцр с разными парами праймеров и при проведении rapd-пцр анализа также

занимала особое положение. Это свойство культуры 34 было постоянным, как и 8, 12 и 27. на рисунке 13 (фрагмент исследований) видно как бы две группы культур отличающихся по распределению молекулярных весов мономеров. Номера 5, 8, 12, имеют схожее распределение

м 12 3 4 5 (, 7 н

рис. 13.- 10 Оэ-нц-пааг электрофорез бактериальных л и зато и культур г. оесгорьогит: 1-5, 2 -8, 3 12. 4 — 21, 5 -28. 6 -34, 7 -38. 8 — йр, м — маркер молекулярного веса с верху вннз(коа): 66—45 —36— 29—24 —20,1 —(фрагмент исследований)

12 ю s е

рис. 14. — Кластерный анализ мономеров культур l39; usobacterium necrophomm с npaihiepom 38, по горизонтали приведены номера исследуемых культур, а но вертикали — уровни подобия.

_г;

_____________lzl_l.

24 2я дн 37 21 19 17 13 2 34 40 26 24 22 16 27 8 9 12 3 is i

белковых фрагментов, Маркировать инструкции и24-18-197-89, отличное от 21,28, 34, 38, 6р методом кластерного анализа результатов электрофореза белковых мономеров культур ризоьайепиш песгорьогит были определены генетические расстояния между изолятами на рисунке 14 выделяются два основных кластера, в первый кластер входят номера культур 1, 3, 8, 9, 12, 15, 16, 22, 24, 26, 27 и субкластер с 2 и 13 отдельной ветвью располагается культура 34 во второй кластер вопли 17, 21, 28, 37, 38 и отдельной ветвью 29

и в завершение был проведен кластерный

и в завершение был проведен кластерный анализ днк девяти культур гичоьастепит песгориотит (рис 15 и 16), дающих наиболее схожие результаты при исследовании в каро-пцр с праймером 38/1 и ею результаты сравнили с результатами кластерного анализа мономеров этих лее девяти культур гичоьастепитп песгорьогит

012345678

рис 15 кластерный анализ днк девяти культур fusobacteiium nccrophorum, дающих наиболее схожие результаты при исследовании в rapd-пцр с праймером 38/1 по торизонтали приведены уровни подобия, а по вертикали -номера исс зедусмых культур

кластерный анализ днк девяти культур fusobacterium necrophorum (1, 2, 3 8, 9, 12, 13, 15, 27), дающих наиболее схожие результаты при исследовании в rapd-пцр с праймером 3839;1 разделил их на две гру ппы (рис 15) в одну вошли культуры 8, 9, 12 15, 27 уровень подобия между собой наибольший во biopyio труппу вошли 1 3 и 13 отдельной ветвыо вчодш 2

кластерный анализ мономеров девяти культур fusobacteiium necrophoium (1, 2, 3, 8, 9. 12, 13, 15 27) разделил их на два кластера (рис 16) в один вошли три субктаетера первый — культуры 1 и 15 в другой — 3, 12, 9 и в

ipeiiiii — 8 и 27 уровень подобия иаибодьшнп между 8 и 27, затем у 3, 12 9 и дачес у 1 и 15 во шорой кластер вошли 2 и 1 3

о 1 2 3 4 t 6

рис 16 — кисгернып анализ мономеров девяти культур г usobacterium necrophorum, дающих наиболее схожие результаты при исследовании в разных шпах пнр по горпзоптати приведены номера исечечуемых кчьтр а по вершка ж ровни подобия

распре лечение по группам при проведении ктастерното анализа днк мономеров девяти ку плур fusobaetcnum necrophorum совпадают за исключением 1, 3 иссчедуемые ку шгуры при геногппировапии по генам тпоизомеразы ii гранспозону, бе гку обочочкп гемат rjnorинину и спенсеру 16s-23s лейкоюкенна были идентифицированы как i usobacterium necrophorum subsp necrophorum песте юваппя полиморфизма мономеров в течение 2-х легнето периода давачи схожие peiyibiaibi 1ю opucnrnpyei на ю, чю была проведена цтсссоциация с г рх к | х рыыч оипомеров, Маркировать инструкции и24-18-197-89, коюрые moiyr быть прпюцны тля исследования в качестве маркеров структурных генов

можно зак почить что исследуемая группа

можно зак почить что исследуемая группа культр данною вида микроорганизмов ока за гась разнородной, несмотря на морфо югичеекое сходство выявленные высокие ноказдте ш потиморфизма вну гриви товых дистанции eiiii тете н. ствую1 о значите 1ыюи бе тковои псодноро птосги популяции псе ie товаппото пи та i usobacterium necrophorum

2 2 2 2 7 изчеиие lenomiioio полиморфизма млыур мусор1лмп е помощью клро-пцр

при анализе днк-паттернов, Маркировать инструкции и24-18-197-89, для установления уровней родства, очень важен выбор «произвольных» праймеров, Маркировать инструкции и24-18-197-89, которые давали бы наиболее информативные картины (паттерны) геномного полиморфизма микоплазм из проанализированных 43 олигонуклеотидов были выбраны и синтезированы 10 после проведения rapd-гщр с референтными культурами микоплазм и сравнения полученных паттернов выявили, что не все сконструированные нами праймеры были пригодны для дифференциации видов возбудителя (табл 5) малоинформативными олигонуклеотидами для дифференциации родов микоплазм оказались 11,12, 23, 32 34, 36, 43 наиболее интересным олигонуклеотидами, на наш взгляд, являются 15 5 39;-gtttcgccca и 39 5 1 -gagegeggte так если паттерны, полученные с помощью праймера 15 сравниваются с

м ьоуеппайшп и с м ьоунпазьрсйз если же за репер взять шт м агцциш, то выявляется высокий уровень гомологии между остальными культурами микоплазм при использовании праймеров 11, 32, 34, 39, 40 и 43, за исключением м ьоущепиайит и м ьоуипабимю схожую дифференциацию выявляет праймер 39 то есть «произвольные» праймеры 15 и 39 дифференцируют м ьоущепцайит от остальных штаммов микоплазм, показывая низкую с ними гомологию, за исключением штамма м ьоуипазнйскз в данном случае, несмотря на то, что гомология достаточно высокая (индексы соответственно 0,89 и 1,0), эти штаммы не идентичны

таблица 5 резу 1ыаш анализа генешческих

таблица 5 резу 1ыаш анализа генешческих профилей штаммов микоплазм с помощью ядро-пцр при попарном сравнении

сравнение с м bovigenitahum

ргштамм м arginini м bovimast м bovirhinis м alcalenses м mycoides е coll staph aureus

12 02 — 0,2 0,22 0,22 — —

15 — 0,89 — — — — —

23 0,22 — 0,29 0,44 0,44 — —

32 0,2 0,33 0,2 0,2 0,2 — —

36 0,4 0,44 0,44 0,67 0,4 — —

15 — — 1 1 1 — —

23 0 22 0 29 0,75 0,8 0 8 0 25 0,29

32 0,2 0,33 1 1 1 — —

34 — — 1 1 1 0,18 0,18

36 0,4 — 0,67 0,83 1 0,2 0,25

39 0,29 0,27 1 1 1 — —

40 0,25 0,2 1 1 1 0,3 03

43 0,38 0,8 1 1 0,93 0,55 0,2

11 0,29 0,57 1 1 1 0,29 0,22

посте проведения яаро-рся с референтными культурами мпкоплазм протзе 1и ко шчес1 венну ю оценку сходства между ними при по парном сравнении полученных паттернов с расчетом индекса подобия из полученных данных следует, что референтные культуры можно разделить на две (таб 1 6) основные труппы в первую — относятся м ьоуеппаьшп и м ьохмтачшкьч, а во вторую-м ьомгьпич м а1са! Ечсепч, м тусон1еь, м агцпит м 11тачинйтч

таб ища 6 гепешческий по шморфизм референтных штаммов микопдазм в каро-рск при попарном сравнении

сравнение с м ьо39; егgt; иа1шт

рг/пп лмч м агцтптпт м 1ад llnast м ъомгып м а]са1счсепя м ту со1с! сь

39 0 29 0 51 0 29 0,29 0,29

сравнение с м ьоуттазшк!

рг/ип лмм 1 а1иттп1 м ьомткп м ьомгьтп м а1са! Ечсепч м тусок1сч

34 0 27 0 ы 0 27 0,27 0 27

сравнение с м а! ?51111111

рг/ш гамм м ьо ттпаь! М ьо39; епт1 м ьомгьт м а1са1ечсеп8 м тусотееч

39 027 0 29 1 0 1,0 1,0

при генотипировании культур, выделенных из одного и того же хозяйства, но в разные годы, использовали выше названные праймеры на основании карб-спектров методом кластерного анализа установили генетические расстояния между родами микоплазм на деидрограмме (рис 17) четко

м ьоунпавпм м тусонкэ м ьстгиииэ

м ьоунпавпм м тусонкэ м ьстгиииэ

м ьоуспиаьиш м акаквсспя м лгдтип

рис 17 — дендротрамма 1 енетнчеекото сходства штаммов мнконлазм в яаро-аналнзе с праимером л« 39 но вертикали — генетические дистанции, по горизонта тн — номера культур

выделяются два кластера один включает м ьоуепиакит и м ьоуттазшкйз, а другой — м ьоу1г1т1пт5 и м аинш во втором кластере молено выделить два подкластера, первый из которых включает в себя м а1са1езсет, второй — м тусонев микоплазмы первого кластера поражают в основном репродуктивные органы животных, а второго — органы дыхания

1сне1ические свя! Н штаммов и изолятв микоплазм отражены на дендрограмме (рис 18) на которой выделяются три кластера один из них, вк почаюшии референтный иламм м ьоусппайит и четыре изолята более однороден и степень сходства составляет 0,72 — 0,81 друтоп кластер содержит м ьо и два пзоляга п степень сходства равна 0,54 — 0,63 39; греши кластер

состоит из м дгутпип и других двух изолятов глс степень сходства по отношению к дру гпм изолягам оказалась значительно меньше — 0,27- 0 36

матшш 09-03 15-03 м ьоуеппайит 13-03 06-01

01-03 м ъоунпабмкь 11-01 16-03 12-01

рис 18 — дентрограмча генетического схо тства референтных штаммов и изолятов микоплазч в ядро-анализе с праймером 39 по вертикали -теиешческие дистанция, но тори зон тали — номера культур

в результате экспериментальных исследований выбраны олигонуклеотидные праймеры 15 и 39, сконструированные на основе анализа днк генов т1трз, ттщр (оперон м§ра) м ьоутцепиаишп полученые данные по дифференциации видов микоплазм с помощью яаро-пцр показали возможность их использования в изучении геномного полиморфизма родов микоплазм

таким образом, построенные по результатам

таким образом, построенные по результатам ядро-анализа дендрограммы по двум видам микроорганизмов согласуются с результатами биологических исследований и, по нашему мнению, более полно отражают степень схожести родов внутри вида исследования геномного полиморфизма возбудителей бактериальных инфекций могут помочь в определении закономерностей появления и циркуляции эпизоотических штаушов в стадах, а также выявлять молекулярную изменчивость микроорганизмов под воздействием различных факторов

3 выводы

1 использование в эпизоотологии молекулярного маркирования генетического материала и оценке его на новой теоретической основе составляет предмет специальной отрасли знания — молекулярная эпизоотология основными объектами и точками приложения молекулярной эпизоотологии являются индикация, дифференциация и полиморфизм микроорганизмов теоретической базой мрнк и днк-маркирования является концепция комплементарности, где основной механизм выявления полиморфное™ является гибридизация применение днк-маркеров решает проблему насыщения генома маркерами и позволяет маркировать практически любые участки днк, в том числе не кодирующие

2 разработанные способы est-phk мономорфного специфического маркирования последовательностей мрнк вируса классической чумы свиней и вирусной диареи крупного рогатого скота с помощью от-пцр позволяют помимо выявления соответствующих вирусов устанавливать циркуляция; вируса вирусной диареи крупного рогатого скота среди свиней и исключать персистенций вируса классической чумы свиней среди крупного рогатого скота

3 разработанный способ stss-днк мономорфного маркирования нуклеотидных последовательностей fusobacterium necrophorum на основе мобильного элемента (транспозона) с помощью гнездовой пцр обладает специфичностью и высокой чувствительностью, которая позволяет проводить маркирование в биологических образцах патогенные fusobacterium necrophorum

4 диагностическая тест-система гнездовой пцр для выявления патогенных fusobacterium necrophorum методом совмещения двух реакций с наружными и внутренними праймерами в одной пробирке позволяет сократить время выделения геномной днк с 22ч до 5ч и снизить стоимость выделения геномной днк в 3 раза сократить время проведения реакции на 2,5 часа и экономить реактивов на 50 реакций пцр

5 сконструирована система полиморфного маркирования, основанная на тестировании однонуклеотидных замен (snps) с помощью пдрф-пцр анализа, позволяющая проводить генотипирование изолятов fusobacterium necrophorum, при использовании специфических наружных 11-12, внутренних 011-022 праймеров и эндонуклеазы mspl, не прибегая к секвенированию ампликонов

6 разработанный способ мономорфного stss-днк маркирования с помощью мультипраймерной пцр может быть примени генетической характеристики и дифференциации на подвиды культур fusobacterium necrophorum с помощью одновременно двух или трех пар праймеров к разным генам одной нуклеотидной последовательности днк возбудителя болезни оптимальный вариант мультиплексной одношаговой пцр для генетической характеристики геномной днк — это использование трех пар праймеров для выявления белка оболочки, топоизомеразы и, гемагглютинина, или двух пар — белка оболочки и гемагпиотинина, где основным дифференцирующим признаком является ген гемагглютинина, присущий только подвиду fusobacterium necrophorum subspecies necrophorum

7 разработанный способ snps-маркирование fusobacterium necrophorum с помощью rapd-пцр и произвольных праймеров, Маркировать инструкции и24-18-197-89, сконструированных на основе нуклеотидных последовательностей лейкотоксииа — 38/1 и протеина — 60-61

fusobacterium necrophorum позволяет выявлять

fusobacterium necrophorum позволяет выявлять степень схожести культур из разных регионов данные маркеры можно использовать при паспортизации культур f necrophorum, а также в определении закономерностей появления и циркуляции эпизоотических штаммов в стадах, выявлять изменчивость микроорганизмов под воздействием различных факторов

8 построенные дендрограммы по данным rapd-пцр анализа более полно отражают степень схожести по сайтам праймирования культур из разных территорий в сравнении с результатами морфологических и биологических исследований выявленные высокие уровни полиморфизма внутривидовых генетических дистанций свидетельствуют о генетической неоднородности популяций fusobacterium necrophorum в сибирском и приволжском регионах степень схожести при использовании праймера 38/1 между основными кластерами находится на уровне 0,42-0,54, а с праймерами 60-61 0,45-0,63, что ориентирует на значительный полиморфизм между культурами

9 на основании полученных данных генотипирования изолятов выбраны два наиболее характерных представителя fusobacterium necrophorum subsp necrophorum штамма штамм 8(8ts630501) и штамм 12 (12tsk630501), принадлежность которых к подвиду necrophorum подтверждена установлением нуклеотидной последовательности генов белка оболочки, топоизомеразып (днк-гираза), гемагглютинина и меж-генной вставки (16s-23s лейкотоксина) нуклеотидные последовательности амплифицированных фрагментов приведены в genbank/ncibi locus dq417656 [gl 89891991] (днк-гираза, топоизомераза ii), dq417657 [gl 89891993] (спейсер), dq335667[gi 84872488] (белок оболочки) и dq341278[gi 85002770] (гемагглютинин) данные штаммы могут быть использованы при разработке диагностических систем и защитных препаратов, Маркировать инструкции и24-18-197-89, а штаммы 12tsk630501 и 8ts630501 fusobacterium necrophorum subsp necrophorum предлагаем считать референтными

10 разработанные две модифицированные методики по выделению геномной днк fusobacterium necrophorum (первая — основная депротеинизация днк fusobacterium достигается обработкой протеиназой к (10мкг/мл) при +55°с в течение 18-20 часов, Маркировать инструкции и24-18-197-89, вторая — основная депротеинизация днк осуществляется обработкой 10 ств при +80°с в течение 1,5 часов использование модифицированных методик позволяет получать чистые препараты суммарной днк от примеси белков, Маркировать инструкции и24-18-197-89, где соотношение d260/d280 равно 1,74-1,75

11 результаты исследования белкового полиморфизма культур fusobacterium necrophorum (несмотря на морфологическое сходство) говорят о высоких показателях внутривидовых дистанций и о значительной белковой неоднородности популяций исследованного вида проведенный кластерный анализ более полно отражает степень схожести культур из разных территорий в сравнении с результатами морфологических и биологических исследований исследования белкового полиморфизма fusobacterium necrophorum помогут в определении закономерностей появления и циркуляции эпизоотических штаммов в стадах, а так же выявлять изменчивость микроорганизмов под воздействием различных факторов

12 разработанная система полиморфного snps-маркирования культур mycoplasm на основе rapd-пцр с праймерами 15 и 39 сконструированных на основе днк генов mhp3, mgp (оперон mgpa) м bovigemtahum может

использоваться в популяционной генетике

использоваться в популяционной генетике микоплазм получаемые с их помощью данные позволяют разграничивать выделенные культуры микоплазм по видам

13 при проведении диагностических исследований общепринятыми методами позволяющими устанавливать наряду с fusobacterium necrophorum наличие, как не идентифицированные fusobacterium, так и fusobacterium pseudonecrophorum и другие анаэробы, морфологически схожие с f necrophorum subspecies necrophorum, но обладающие несколько большей энергией роста доля чистых культур при этом способе составляет около 30 (одной трети от всех выделенных анаэробов)

14 использование в эпизоотологии молекулярного маркирования генетического материала позволяет на примерах мрнк и днк содержащих микроорганизмов применять различные днк — маркерные системы для обнаружения, разграничения по видам и подвидам, установления полиморфизма патогенных микроорганизмов при генетическом маркировании мрнк и днк микроорганизмов распространение получили методы, основанные на полимеразной цепной реакции в экспериментах показана возможность использовать различные типы маркеров, Маркировать инструкции и24-18-197-89, для индикации, дифференциации и изучения генетических признаков микроорганизмов содержащих мрнк (вирусов классической чумы свиней и вирусной диареи крупного рогатого скота) и flhk(fusobacterium necrophorum и mycoplasm)

4 практические предложения

научные разработки и положения диссертационной работы нашли отражение в нормативных документах, освоенных ветеринарной практикой

— инструкции «тест-система для выявления fusobacterium necrophorum subspecies necrophorum методом полимеразной цепной реакции с помощью гнездовых праймеров» и ту 9388-001-05095732-2006 (федеральная служба по ветеринарному и фитосанитарному надзору рф свидетельство о государственной регистрации пвр-1-2 6/01846 от 20 февраля 2007 г учетная серия 35-1-2 6-1495)

временная инструкция по применению тест

временная инструкция по применению тест-системы для выявления патогенных fusobacterium necrophorum методом совмещенной гнездовой полимеразной цепной реакции (two in one nested pcr, утвержденная директором гну иэвсидв со расхн, 2006,

— временная инструкция по применению тест-системы для генотипирования культур fusobacterium necrophorum методом применение rapd-пцр анализа для молекулярно-генетического картирования культур fusobacterium necrophorum, утвержденная директором гну иэвсидв со расхн, 2006

5 список работ, опубликовнных по 1lml диссертации

1 выявление вируса классической чумы свпиеп с помощью полимеразной цепной реакции39; (оавт л 1 пузырев, Маркировать инструкции и24-18-197-89, с ф орешкова, с донченко, в м чскишев, Маркировать инструкции и24-18-197-89, л ильичев // молекулярная генешка, мпкробиоло! Ия и виру со ни ия м — 1999 -ш — с 27-30

2 о lnronvk3coiи шые прапчеры в дпапюсшческих leci-cncicmax для дифференциации вирусов классической чумы свннеи и вирусной диареи крупного

рогатого скота39; соавт с а юрик //сибирский вестник сельскохозяйственной науки новосибирск -2000 -1-2 — с 99-104

3 дифференциальная диагностика классической чумы свиней и болезни слизистых оболочек крупного рогатого скота методом полимеразиой цепной реакции/ соавт с а юрию39;/ доклады ра схн м -2000 -1 -с 37-39

4 полимсразная цепная реакция с гнездовыми праймерами в диагностике 1 usobacterium neerophoruin / соавт ii в некрасова а а самоловов, Маркировать инструкции и24-18-197-89, ii 11 блинова /39; сибирский вестник сельскохозяйственной пау кп новосибирск — 2002 -3-4 -с 100-105

5 i еногнпирование патогенного биотипа ав hububacterium neerophoruin subsp neerophoruin / соавт ma филипенко ii в некрасова, с а храпов а а самоловов 39;/сибирский весшик сельскохозяйственной пауки новосибирск-2003,-1 — с 86-90

6 пцр-гснетическое типирование i usubactciium ncciophorum с помощью анализа пдрф синтезированного амплнк39; она / соавт ма фигтипснко, ii в некрасова ел храпов л а самоловов //сибирский весшик сельскохозяйственной науки новосибирск — 2003 -3(149) -с 124-127

7 транспозоны в передаче патогенных свойств rusobactenum necrophorum subsp necrophorum биотипа ав/соавт ас донченко, в м блинов, Маркировать инструкции и24-18-197-89, дв сараев ал самоловов, Маркировать инструкции и24-18-197-89, с в лопатин //сибирский весшик сельскохозяйственной науки

11овосибнрск — 2003 — 4 — с 84-87

8 полиморфизм днк изолятов возбудителя некробактериоза крупного рогатого скота в западной сибири /соавт с а юрик, ю а горбунов, Маркировать инструкции и24-18-197-89, а а самоловов, Маркировать инструкции и24-18-197-89, с в лопатин, е в дударева // сибирский вестник сельскохозяйственной науки новосибирск — 2005 — 2 — с 98-102

9 выявление гена гемагглютинина fusobacterium necrophorum с помощью полимеразиой цепной реакции /соавт д а хузин, с а юрик, x н макаев, Маркировать инструкции и24-18-197-89, е в дударева // сибирский вестник сельскохозяйственной науки новосибирск —

2005 -3 -с 83-87

10 разграничение fusobacterium necrophorum на подвиды с помощью дуплексной одношаговой полимеразиой цепной реакции /соавт е а храпов, Маркировать инструкции и24-18-197-89, с а юрик, м а филипенко, е в дударева //сибирский вестник сельскохозяйственной науки новосибирск — 2005 — 3 — с 87-92

11 исследование геномного полиморфизма гнолягов fusobacterium necrophorum в приволжском округе/соавт д а хузин, xii макаев с а юрик г в дударева // сибирскии вестник сельскохозяйственной науки новосибирск -2005 — 4 — с 131-135

12 дифференциация i usobactenum necrophorum на подвиды с помощью дуптскспон оцношаговои полимеразнои цепной реакции 39; соавт е. а храпов, Маркировать инструкции и24-18-197-89, с а юрик, ма филипенко//доклады россе гьхозакадемнн м — 2006 — 1 -с 51-53

13 сравнительная индикация fiisobacternim neerophouim бактериологическим методом и с помощью гнездовой пцр /соавт самоловов а а караваев ю д. лопатин с в. семенова и н // сибирский весшик сельскохозяйственной науки новосибирск — 2006,- 2 — с 92-96

14 использование однопраймерион полимеразиой цепной реакции для изучения межвидового геномпото полиморфизма у микоилазм/соавт с а юрик, м ii шадрина // сибирский весшик сельскохозяйственной науки новосибирск —

2006 — 3 -с 86-9!

15 использование rapd-pcr анализа в исследовании молску шрно теистическою полиморфизма культур г usobactenum necrophoium и mycoplasm /солвг с а юрик, да ху зин//сибирскии вестник сельскохозяйственноп науки новосибирск -2007 — 1 -с 76-82

16 генстческии полиморфизм днк кулыур fusobacteiium nccrophorum по данным каро-анллнза /соавг га юрик, да ху зпн //доклады россельхозакадемпи м -2007 — 2 — с 52-56

17 иссшдовапие полиморфизма олигомеров культур rusobacterium ncciopliorum39; c а юрик, д а хузип, а в мокеева it о с воронова, е в ду иревсибирскнн вестник сельскохозяйственной науки -2007 — 3 — с 76-82

18 патеш 2120994 от 27 октября 1998 способ выявления вируса к иссическоп чумы свиней / солв! At пу зырев, Маркировать инструкции и24-18-197-89, а с допчепко, с ф орешкова, вм чекишев, Маркировать инструкции и24-18-197-89, а а ильичев// — заявшель и патентообладатель гну иэвсидв сорасхн н 1 ни вь «вектор» — заявка 97103934 от 1203 1997 — ьюп 30

19 патент 2158306 от 27 октября 2000 г способ выявления вируса вирусной диареи (болезни стизнсшх обо ючек) крупною рогаюю скота с помогиыо специфических олигону к ieoiилных праимеров в полимеразной цепной реакции / соавт а с донченко, с ф орешкова, в м чекишев, Маркировать инструкции и24-18-197-89, с а юрик а а ильичев // заявше ib и naienтообладателн гну иэвсидв со расх11 и гнц вб «векюр» — заявка 99101603 oi 19 января 1999 -бюч 30

20 патент 2203951 от 10 мая 2003 i способ выявления i usobactenum neciophoium в генездовоп пцр / соавт а а самоловов, Маркировать инструкции и24-18-197-89, с а юрик, 1111 блинова н в некрасова // заявшель и па1енкюблада1елн гну иэвсидв со расxi1 и i ни, вь «вектор» по заявке 200! 133577 от 10 12 2001 — ьюл 13

21 патент 2294374 or 27 февраля 2007 г способ определения в пробе naioiemioro подвида rusobacterium neciophorum subspecies necrophorum с помощью полимера зной ценной реакции /соавт с а юрик, ев дударева // заявитель и паченгооб тачатель i ну иэвсидв со pacxii по заявке 2004125139/13 от 03 08 2004 — ьюл 6

22 получение матричной рнк вируса вируснои диареи крупною poiaioio скота для ее после ту loniei о клонирования /соавт. В а кру i тяк //iii всесоюзная конференция по эпизоотологии — новосибирск, 24-26 сент 1991 — новосибирск -1991 -с 251-252

23 выде теине рнк вируса классической чумы свинеи// научное обеспечение ветеринарных проб тем в животноводстве (со науч ip i ну иэвсидв со расхп) — новосибирск — 2000 — с 329-133

24 дпамкхшка боте ?пи слизистых оболочек крупного ротатого скота и к 1л.

ст1чсскот1 чумы евинеи с помошыо но тттмера

ст1чсскот1 чумы евинеи с помошыо но тттмера зной ценной реакции /соавт а с донченко вм чекишев, Маркировать инструкции и24-18-197-89, сф орешкова, с а юрик /39; развитие агропромышленной комптекса в зонах рискованного земледелия материалы vi научпо-практическоп конференции г новокузнецк -1999 -с 29-30

2s вы телепне и очистка м-i39; hk вируса вируснои диареи крупною роиттою скота соавт в кру i 1як //инфекционные болезни животных;)пи зоотолот ия итат нос тика, профи тактика и меры борьбы со науч гр — со рлсхн — гну и )всндв — новосибирск — 1991 — с 103-106

26 клонирование фра1мсша теномнон рнк вируса вирусной тиарсн крупного рогатого ском, кодирующего ген gp48 /соавт с а юрик сф орешкова в и афонюшкин //проблемы стаби шзацнн и развития сельскою хозяиствч казахстана сибири и монтотин — 3-я между народная науч — ттракт

конф (алматы 18-19 июля — 2000)/с0 расхн — новосибирск — 2000 -с 195196

27 выцеленис хромосомной днк 1 usobactenum nccrophorum /соавт а а самоловов, Маркировать инструкции и24-18-197-89, с в лопатин //научное обеспечение ветеринарных проблем в лч39; ивошоводстве (сб научных фудов ) новосибирск -2000 -с 163-166

28 применение полнмеразной цепной реакции для обнаружения вируса болезни слизистых оболочек парнокопытных животных /соавт вм чекишев, Маркировать инструкции и24-18-197-89, сф орешкова, с а юрик //научное обеспечение ветеринарных проблем в /кивогноводстве (сб науч ip ) новосибирск — 2000 — с 130-134

29 возможность прижизненной диагностики классической чумы свиней и болезнзт слизистых оболочек крупного рогатого скота /соавт с и прудников, Маркировать инструкции и24-18-197-89, с. а юрик, а а духовский // научное обеспечение ве1ерпнарных проблем в живошоволстве (сб нач ip ) новосибирск -2000 -с 183-186

30 получение геномной библиотеки в плазмидном векторе хромосомной днк г nccrophorum /соавт а а самоловов, Маркировать инструкции и24-18-197-89, с а юрик, н в некрасова, сф орешкова //проблемы стабилизации и развития сельского хозяйства казахстана, сибири и монголии материалы 3-й междунаролной науч-практ конф (алматы, 18-19 июля 2000 г )/расхп сиб отд-нне новосибирск -2000 — с 195-196

31 сравнительный анализ специфичности и чувствительности полнмеразной пенной реакции с методами индикации вируса классической чумы свиней на культуре клеток /соавг вм чекишев, Маркировать инструкции и24-18-197-89, си прудников, Маркировать инструкции и24-18-197-89, тм 1 лотова, не 11анова //11аучнос обеспечение ветеринарных проблем в животноводстве (сб науч ф ) новосибирск — 2000 — с 134-139

32 использование кдпк, специфичных вирусу классической чумы свиней, для дифференциации pestiviruses /соавт с ф орешкова //научное обеспечение ветеринарных проблем в животноводстве (сб науч тр ) новосибирск — 2000 -с 143-150

33 выбор специфических олигонуклеотидных праймеров// научное обеспечение ветеринарных проблем в животноводстве (сб науч тр ) новосибирск -2000 -с 167-173

34 использование по тимеразной цепной реакции для обнаружения rna вируса классической чумы свинеи /соавт at пузырев а с донченко. С39; ф орешкова вм чекишев, Маркировать инструкции и24-18-197-89, а а ильичев //научное обеспечение ветеринарных проблем в животноводстве (сб науч ip ) новосибирск — 2000 — с 174-178

35 о возможности эволюционной изменчивости представителей пестивирусов классической чумы свиней и вирусной диареи/соавт ю и вульф, к с макарова //научное обеспечение ветеринарных проблем в животноводстве (сб науч тр ) новосибирск — 2000 — с 179-183

36 клонирование хромосомной днк fusobactenum neciophorum / соавт ii в некрасова //ьолсзни сельскохозяйственных животных вирусной и других это ю1 ии и меры борьбы с ними (материалы научпо-практическон конф-иркутск — 2001 — новосибирск -2001 -с 111-112

37 разработка биотинилнрованного днк-зонда на основе кднк гена gp48 вируса виру спои диареи крупного рогатого скота, клонированного в плазмндньпт вектор /соавт в н афоптошкин //болезни сельскохозяйственных животных вирусной и другой этнологии и меры борьбы с нимт/материалы научно-практической конференции (иркутск, 6-7 сентября 2001) — иркутск — 2001 -с 36-37

38 выяв iemie и идентификация rusobacterium necrophorum с помощью полимеразной цепной реакции и гнездовых прайчеров /coabi h в некрасова ал самозовов //ьнотого-экологичсские проблемы заразных болезней диких /кпвошых и их роль в патологии сельскохозяйственных животных и людей (магерна 1ы международной научно-практической конф покров 16-18 апр 2002 i ) покров -2002 -с 251-252

39 дифференциальная диагностика вирулентного биотипа ав 1 usobactenum necrophoium subsp neciophorum с помощью пцр и пдрф ампликопов /соавт п в некрасова. А а самоловов //материалы первою международною конгресса (алматы 10-11 октября 2002) алматы -2002 — г4 — с 171-173

40 дифференциальная диагностика rusobacterium necrophorum у мелкого и крупною poiaioio ckoia с помощью нолнмеразнон цепной реакции /соавт h в некрасова, а а самоловов //науч обеспеч апк сибири, монгочии, казахстана, беларуси и башкортостана матер 5-ой междунар науч — практ конф (абакан, 10-12 июля 2002) расхп сиб отделение новосибирск — 2002 — с 468-471

41 дифференциация сходных по фенотипу fusubacterium necrophorum subsp neciophorum с помощью анализа пдрф синтезированного ампликона /соавт ma филипенко, п в некрасова, еа храпов, Маркировать инструкции и24-18-197-89, а а самоловов //ветеринарные и медицинские аспекты зооантротгонозов //труды международ научно-практическ конференции посвяти 45-леппо института 24-26 сещ. 2003 Т 4acib 1, покров -2003 — с 304-308

42 исследование полиморфизма днк изолятов rusobacterium neciophorum/соав1 с а юрик, ю а горбунов //«maiepiiajibi международной научно-практической конференции «современное состояние и актуальные проблемы развития ветеринарной науки и практики», посвященной 100-летию института» 15-16 сентября 2005 г. галматы, казниви, т1 инфекционные болезни с -249-252

43 дифференциация husobacterium necrophorum методом пцр-анализа /соавт h в дударева //новейшие направления развития аграрной науки в работах молодых ученых тр 2-й междунар конф мол ученых (20-21 апреля 2006 т. нос краснообск) / расхн сиб ош-ние — новосибирск 2006 — 656 с — с 398-402

44 идентификация rusobacterium песгорьогит//актуальиые проблемы ветеринариою обеспечения живошоводства сибири сб науч ip /расхн сиб от-тпте гну иэс39; идв — новосибирск -2006 — с 322-327

подписано в печать 15 05 2007 г формат

подписано в печать 15 05 2007 г формат 60×84 39;/|6 печ л 2,0 тираж юоэкз заказ 154

ооо ипф «агрос» 630501, новосибирская область, пос краснообск

габузов о. с. (ред.) Искусственное разведение фазанов (методические рекомендации).

габузов о. с. (ред.) Искусственное разведение фазанов (методические рекомендации). цнил главохоты рсфср. Москва, 1987. 142 с.

отдел дичеразведения

30 декабря 1986 г.

в. и. фертиков

искусственное разведение фазанов

1. краткая история фазановодства

2. цели искусственного разведения фазанов

3. выбор формы фазана для искусственного разведения

4. выбор участка для организации фермы

5. постройки и сооружения фермы

6. оборудование, инвентарь, измерительные приборы

17. требования к качеству инкубационных яиц

20. выращивание молодняка

21. направленное выращивание молодняка фазанов, Маркировать инструкции и24-18-197-89, предназначенного для выпуска в угодья

22. организация труда и учета на дичеферме

23. ветеринарно-профилактические мероприятия в фазанарии

24. интродукция искусственно выращенных фазанов в охотничьи угодья

25. организация охоты на выпущенную дичь

26. экономика искусственного разведения фазанов

приложения

1. указатель типовых проектов ферм по искусственному разведению фазанов

2. основные нормативы для проектирования фазанариев и расчетные зоотехнические показатели, применяемые при их разработке

3. содержание питательных веществ и энергии в 100 г различных кормов

4. содержание аминокислот в различных кормах

5. ориентировочная сметная стоимость строительства ферм по разведению фазанов с разным выходом готовой продук­ции

6. ориентировочное штатное расписание ферм по разведению фазанов

7. прейскурант на продукцию дичеферм госохотохозяйств главохоты рсфср

8. калькуляция себестоимости продукции

9. ориентировочная калькуляция себестоимости продукции при выращива-нии 100 тыс. Голов фазанов и 240 тыс. Бройлеров

10. расчет суммы годовой прибыли, окупаемости капвложений, уровня рентабельности

11. технико-экономические показатели

12. форма инкубационной ведомости

13. форма журнала учета яйцекладки

рекомендуемая справочная литература для

рекомендуемая справочная литература для «библиотеки фазановодства»

освоение территорий, интенсификация народного хозяйства ослабляют воспроизводство многих видов пернатой дичи, что приводит к сокращению ее численности. В густонаселенных районах страны стали редкими глухарь, тетерев, Маркировать инструкции и24-18-197-89, серая куропатка, перепел многие другие охотничьи виды.

в современных условиях развитие охотничьего хозяйства вызывает необходимость использования новых систем его ведения, обеспечивающих интенсификацию этой отрасли природопользования. Одной из таких систем является искусственное дичеразведение и, в частности, искусственное разведение фазанов. С помощью этого приема возможно насыщать дичью охотничьи угодья к началу охоты. К этому есть определенные экологические, биологические и охотохозяйственные предпосылки.

емкость большинства современных охотничьих угодий в летне-осенний период обеспечивает жизненные условия для большей численности дичи, чем может появиться ее в результате ослабленного естественного воспроизводства. Именно на воспроизводство в первую очередь оказывают влияние отрицательные факторы, вносимые деятельностью человека. Таким образом, летне-осенняя емкость оказывается «незаполненной». С помощью искусственного дичеразведения становится возможным реализовать этот резерв за счет выпуска в угодья молодняка, выведенного на дичефермах.

зимние условия обитания всегда были трудным периодом для дичи, а в трансформированных угодьях особенно. Для большинства видов охотничьих птиц отход за зиму превышает 50 осенней численности, а в отдельные годы составляет 70-80. перезимовавшее поголовье под действием факторов, Маркировать инструкции и24-18-197-89, свойственных антропогенным ландшафтам, ослабляющих естественное воспроизводство, не обеспечивает высокой численности дичи к сезону охоты. Летне-осенняя емкость угодий вновь оказывается «незаполненной». Поэтому выпуски дичи, выращенной на фермах, должны быть ежегодными и имитировать результат высокого уровня естественного воспроизводства. Основная масса выпущенной дичи должна отстреливаться в охотничий сезон. В противном случае она все равно погибнет зимой и не обеспечит заметного увеличения численности на будущий год. Вот почему искусственное дичеразведение мы вправе рассматривать как особую систему ведения охотничьего хозяйства в трансформированных угодьях: «посев» дичи и своевременное «снятие урожая» до наступления периода, когда он «погибнет на корню».

родина фазана — центральная и южная азия

родина фазана — центральная и южная азия. Северная граница его естественного распространения хорошо совпадает с зонами, где снежный покров непродолжительный, неустойчивый и его высота не превышает 20 см. Так зачем заниматься разведением фазана за пределами его естественного ареала, в широтах с суровыми зимами, высоким снежным покровом, который сохраняется в течение 4-5 месяцев. Не лучше ли заняться искусственным разведением аборигенных видов, Маркировать инструкции и24-18-197-89, таких как глухарь, тетерев, Маркировать инструкции и24-18-197-89, перепел, серая куропатка, вальдшнеп и т. п.?

во-первых, технология массового искусственного разведения этих видов еще не разработана в отличие от фазана. Серую куропатку, правда, разводят на дичефермах, но эффективность ее выпусков пока ниже, чем фазана. Во-вторых, для искусственного дичеразведения условия зимнего существования дичи в угодьях и возможности ее естественного воспроизводства в них не имеют значения. Фазаны в неволе хорошо переносят суровые зимы, а молодняк, выпущенный в угодья, обеспечен условиями существования летом и осенью до установления глубокого снежного покрова, который, при наличии подкормки, позволяет птицам пережить зиму. Правда, и в этом случае естественное воспроизводство перезимовавших фазанов крайне низкое. Даже в такой стране, как болгария, с ее теплыми зимами, невысоким и непродолжительным снежным покровом, коэффициент естественного прироста поголовья фазанов, Маркировать инструкции и24-18-197-89, обитающих на воле, не превышает 0,5-0,3. но для искусственного дичеразведения это не имеет значения. Вот почему фазанов с успехом разводят даже в финляндии.

фазановодство развито на всех континентах планеты (кроме антарктиды), и в настоящее время в мире ежегодно выращивают и выпускают в угодья около 50 млн. Голов фазанов.

для удовлетворения потребности охотников

для удовлетворения потребности охотников-спортсменов выпуски дичи должны быть ежегодными, а их количество — достаточно большим. Отсюда возникает необходимость создания крупных дичеферм, которые не могут функционировать без применения промышленной технологии, обеспечивающей наивысшие показатели при наименьших затратах.

успех использования искусственного разведения фазанов в охотничьем хозяйстве зависит от правильного, научно-обоснованного подхода при решении каждого из разделов этого комплексного приема: содержания, кормления, разведения на фермах, выпуска молодняка в угодья, проведения в них биотехнических мероприятий, своевременной и эффективной охоты на выпущенную и выросшую в угодьях дичь.

всесторонняя комплексная научная разработка этих вопросов впервые предпринята сотрудниками отдела дичеразведения цнил главохоты рсфср. Коллектив авторов надеется, что методические рекомендации окажутся полезными для развития искусственного разведения фазанов и помогут охотничьим хозяйствам успешно выполнять эту работу. Отзывы и пожелания просим направлять по адресу: 129347, москва, лосиноостровская лесная дача, квартал 18, цнил главохоты рсфср, отдел дичеразведения.

1. краткая история фазановодства

история фазановодства уходит в глубь веков. Легенда о золотом руне приписывает предводителю аргонавтов ясону завоз фазанов в грецию с берегов р. фазис (ныне р. рион) из колхиды (грузия). вероятно, основываясь на этой легенде, карл линней дал фазану его латинское название — phasianus colchicus, закрепив эти два географических названия древней грузинской земли за всеми обыкновенными фазанами мира.

аристофан (445-385 гг. До и. э.) в комедии

аристофан (445-385 гг. До и. э.) в комедии «облако» упоминает о фазанарии. Римский писатель палладий (iv в. н. э.) описывает подробности разведения фазанов в неволе. Диоклециан (285-305 гг. Н. э.) упоминает о ценах на диких фазанов и выращенных в фазанариях, причем последние стоили на 100 динаров дороже добытых в природе.

в англию фазаны попали еще в период римских войн и, по сохранившимся документам, уже в 924 г. их разводили в неволе. Именно в англии достигли значительных успехов в массовом разведении фазанов на специальных фермах, и она по праву считается родиной фазановодства. В центральной и западной европе разведение фазанов в искусственных условиях известно с xi в. широкое распространение получает в xiv—xv вв. В xviii—xix вв. Фазановодством начинают заниматься почти во всех европейских государствах. В xix в. фазанов завозят в северную америку, австралию, новую зеландию, где птиц также начинают разводить в искусственных условиях. В россии первые фазанарии появляются в конце xix в. и в некоторых имениях их разведение на фермах становится доходной отраслью птицеводства (битых фазанов доставляли в петербург и москву и продавали по высоким ценам — до 5 руб.).

о масштабах фазановодства в начале века можно судить по описанию одной из охот, устроенных в честь императора вильгельма ii 19 октября 1913 г. в окрестностях бенишау (австрия), во время которой было убито 3200 фазанов.

с изобретением инкубаторов, Маркировать инструкции и24-18-197-89, которые позволили

с изобретением инкубаторов, Маркировать инструкции и24-18-197-89, которые позволили сделать гигантский скачок в развитии птицеводства, в фазановодстве также начинается новый индустриальный этап. В настоящее время имеются крупные промышленные фазанарии с ежегодным выращиванием 100-200 тыс. Голов молодняка фазанов в год. В одной только англии ежегодно для выпуска в охотничьи угодья выращивают более 7 млн. Голов фазанов, Маркировать инструкции и24-18-197-89, в венгрии — около 900 тыс. В болгарии — до 1 млн. Голов. Благодаря большим масштабам искусственного разведения фазанов, Маркировать инструкции и24-18-197-89, во многих странах этот вид стал ведущим трофеем в добыче охотников-спортсменов.

на территории ссср первые фазанарии возникли, как уже указывалось, на рубеже xix и xx вв. В киевской, новгородской, орловской, волынской губерниях, в прибалтике, под петербургом и москвой. Этот первый, дореволюционный этап, характеризуется развитием фазановодства в имениях крупных помещиков. В разведении фазанов использовали кур или индеек в качестве наседок, в выкармливании молодняка использовали естественные корма (в частности, «муравьиные яйца»). после революции попытки искусственного разведения фазана возобновляются в 30-х годах и прерываются с началом великой отечественной войны (ii этап фазановодства). технология фазановодства на этом этапе не изменяется, хотя делаются попытки использования инкубаторов для выведения молодняка фазанов. В 50-х годах возникают новые фазанарии на украине, в рсфср, прибалтике, белоруссии. Самый первый из действующих до настоящего времени фазанарий был организован в 1956 г. в крыму («холодная гора») близ белогорска. Вначале здесь также использовали кур-наседок, но в 60-е годы перешли на инкубаторы.

в 1958 г. в подмосковном дубненском охотохозяйстве

в 1958 г. в подмосковном дубненском охотохозяйстве московского общества охотников начинает функционировать первый в стране фазанарий с ориентацией на выведение молодняка в инкубаторах и выращивание его без участия взрослых птиц (куры, индейки). в 1959 г. по такой же технологии начал работать майкопский фазанарий главохоты рсфср. Однако на этом, iii этапе развития фазановодства в ссср, еще не было научно обоснованной технологии искусственного разведения фазанов, Маркировать инструкции и24-18-197-89, имевшийся зарубежный опыт еще не был переработан с учетом специфических условий нашей страны. Много дичеферм по разведению фазанов, Маркировать инструкции и24-18-197-89, возникших в этот период, вскоре было закрыто, и только 2 («холодная гора» и майкопский фазанарий) функционируют по сей день. В 70-х годах начинается новый, iv, современный этап в фазановодстве. Развертываются серьезные научные исследования, позволившие разработать современную технологию искусственного разведения фазанов, Маркировать инструкции и24-18-197-89, включающую все его разделы: от формирования родительского поголовья на дичеферме до выпуска молодняка в угодья и охоты на фазанов, Маркировать инструкции и24-18-197-89, в которой получили обобщение зарубежный и отечественный опыт фазановодства с учетом достижений современного промышленного птицеводства. Это позволило разработать типовые и индивидуальные проекты фазанариев, Маркировать инструкции и24-18-197-89, рецептуру комбикормов на основе компонентов, Маркировать инструкции и24-18-197-89, применяемых в отечественной комбикормовой промышленности, осты на полнорационные комбикорма, подготовить методические и учебные пособия и т. д. в настоящее время дичефермы по разведению фазанов имеются в молдавии, белоруссии. Прибалтике, на украине, в приморском и краснодарском краях. Крупные фазанарии строятся в ставропольском и краснодарском краях, в грузии, азербайджане, казахстане, на украине.

искусственное разведение фазанов возникло

искусственное разведение фазанов возникло как прихоть крупных рабовладельцев, Маркировать инструкции и24-18-197-89, а позднее — землевладельцев и было своего рода модой, погоней за экзотической охотой и дичью. Однако уже в xix в. в связи с освоением территорий и бурным развитием хозяйственной деятельности во многих странах началось резкое сокращение численности дичи. Искусственное диче-разведение и фазановодство в первую очередь становится одним из эффективных приемов интенсификации воспроизводства ресурсов пернатой дичи.

на огромной территории ссср, с ее богатством и разнообразием ресурсов животного мира, необходимость искусственного дичеразведения возникла лишь в самое последнее время в связи с бурным развитием народного хозяйства, его интенсификацией и ускорением научно-технического прогресса.

перед фазановодством в ссср открывается широкое будущее. В то же время имеется ряд организационных и экономических сложностей, возникающих в первую очередь из-за непонимания целей, задач и возможностей искусственного дичеразведения вообще и фазановодства в частности, из-за нежелания пересмотреть старые, привычные представления об охотничьем хозяйстве с учетом современных экологических условий.

2. цели искусственного разведения фазанов

2.1. основная цель искусственного разведения фазанов, Маркировать инструкции и24-18-197-89, как уже упоминалось во введении, — это насыщение ими угодий к началу охотничьего сезона для увеличения ресурсов дичи и проведения охот.

2.2. разведение какого-либо подвида обыкновенного фазана может предприниматься для искусственного поддержания численности его в пределах естественного ареала или расширения последнего за счет заселения новых территорий, пригодных для естественного обитания и размножения. При этом могут преследоваться охотничьи цели или необходимость сохранения генофонда узкоареальных эндемичных подвидов. Примером работ первого направления может служить северокавказский фазан, ареал которого благодаря деятельности майкопского фазанария не только сохранен, но и значительно расширен за счет выпуска птиц из ди-чепитомника во многие районы краснодарского края, ростовской и волгоградской областей, где в некоторых угодьях численность его достигла эксплуатационной. Второе направление работ можно проиллюстрировать на примере зарафшанского подвида. Его численность в природе не превышает 2-3 тыс. И сохранился он в основном в пределах зарафшанского заповедника. Создание здесь небольшого питомника по искусственному разведению этого подвида гарантирует от катастрофического снижения численности, связанного с какими-либо случайными причинами (пожар в тугае, суровая многоснежная зима, неурожай основных кормов и т. п.).

2.3. фазаны уничтожают большое количество вредных для сельского хозяйства насекомых, в том числе колорадского жука и его личинок. Выпуск фазанов на сельскохозяйственные поля способствует снижению численности вредных насекомых. Это не значит, что фазан в состоянии полностью унич-тожить, скажем, колорадского жука. Но существенно сократить его численность возможно, используя такой способ биологической борьбы с этим вредителем.

2.4. искусственно выращенных фазанов можно использовать и с эстетической целью, выпуская их в природные парки 10 и зеленые зоны.

3. выбор формы фазана для искусственного

при разведении фазанов в европе, америке

при разведении фазанов в европе, америке, австрии, то есть далеко за пределами естественного ареала, вопрос, какого фазана разводить, не имеет принципиального значения. Здесь, как правило, разводят так называемого охотничьего фазана — гибрида, полученного в результате бессистемного скрещивания разных подвидов фазанов. Некоторые формы охотничьего фазана больше походят на тот или иной подвид, однако это не свидетельствует об их чистокровности. Всего на азиатском материке насчитывают до 42 подвидов обыкновенного фазана, из которых 12 обитает на территории ссср.

3.1. в пределах естественного ареала какого-либо подвида обыкновенного фазана и на прилегающих территориях нельзя искусственно разводить и выпускать в угодья фазанов другого подвида или гибридного (охотничьего). массовые выпуски фазанов других форм в угодья, где обитает определенный подвид фазана, неизбежно приведут к гибридизации и потере генофонда аборигенного подвида, что запрещено законом ссср и союзных республик «об охране и использовании животного мира». Следовательно, в охотничьих хозяйствах, расположенных в ареале подвида или на сопредельных с ним территориях, возможно искусственно разводить на дичефермах и выпускать в угодья только аборигенный подвид.

3.2. на территориях за пределами естественного ареала и не граничащих с ним возможно разведение любой формы обыкновенного фазана, включая и охотничьего. Разведение последнего даже предпочтительнее, так как он крупнее многих подвидов, Маркировать инструкции и24-18-197-89, более пластичен, адаптирован к искусственному разведению, дает высокие зоотехнические показатели при разведении в неволе.

3.3. достаточного научно обоснованного детального районирования территории ссср для разведения различных форм фазанов еще не проведено. Однако для европейской части рсфср можно считать, что на побережье каспия в астраханской области и калмыцкой асср, в ставропольском и краснодарском краях, в ростовской и волгоградской областях следует разводить и выпускать только северокавказского фазана. На остальной территории европейской части рсфср, а также в прибалтике, белоруссии, молдавии и на украине целесообразно заниматься искусственным разведением охотничьего фазана. На дальнем востоке, в приморском и хабаровском краях можно разводить только маньчжурский подвид фазана. В закавказье, где обитает 2 подвида — закавказский и талышский, допустимо разведение первого, но его выпуски не должны распространяться на ареал талышского фазана (на юге азербайджана в талыше).

вопрос районирования для среднеазиатских

вопрос районирования для среднеазиатских республик еще не решен. Здесь на сравнительно небольшой территории обитает 9 подвидов, Маркировать инструкции и24-18-197-89, сформировавшихся в условиях экологической изоляции. В настоящее время в связи с антропогенным преобразованием территорий эта исторически сложившаяся экологическая изоляция подвидов нарушается и возникает серьезная угроза проникновения особей одного подвида в ареал другого по оросительным каналам и сельскохозяйственным полям. Таким образом, вопрос сохранения генетической чистоты среднеазиатских подвидов стоит достаточно остро и без искусственного дичеразведения. В казахстане обитает семиреченский фазан, которого и следует здесь разводить в искусственных условиях.

3.4. в связи с интенсивным разведением фазанов, Маркировать инструкции и24-18-197-89, которое открывает возможности выращивания для выпуска в угодья десятков и сотен тысяч птиц, встает проблема искусственного создания непреодолимых для фазанов рубежей, препятствующих проникновению одной формы фазана в ареал других.

такая ситуация уже возникла на границе ростовской области, в которой расселяли северокавказского фазана, с усср, где разводят и производят массовые выпуски охотничьего фазана.

единственный реальный путь предотвращения подобного рода гибридизации в природе — это создание достаточно широкой полосы, до 50-100 км, на стыке ареалов, Маркировать инструкции и24-18-197-89, в пределах которой во всех охотничьих хозяйствах и заказниках (если таковые попадут в эту полосу) обыкновенный фазан (независимо от его формы) должен будет подлежать истреблению как вредное животное. Такая буферная зона (полоса) в состоянии предотвратить гибридизацию.

3.5. охотничьи хозяйства, попавшие в эту буферную зону, лишаются, таким образом, объекта охоты — обыкновенного фазана. Заменить его можно другим видом — королевским фазаном, который заполнит пустующую нишу.

искусственное разведение королевского фазана

искусственное разведение королевского фазана освоено достаточно хорошо, мало чем отличается от технологии разведения в неволе обыкновенного фазана. Выпуски выращенных на дичефермах королевских фазанов достаточно эффективны, и их использование для охотничьих целей хорошо зарекомендовало себя в чехословакии и ряде других стран. Королевский фазан, если и гибридизируется с обыкновенным, то потомство не плодовито, что не угрожает засорению генофонда последнего. В то же время охотничьи хозяйства, оказавшиеся в буферной зоне, смогут иметь охоту на фазана. По сведениям чехословацких специалистов, Маркировать инструкции и24-18-197-89, охота на королевского фазана представляет своеобразный интерес.

3.6. технология искусственного разведения аборигенных подвидов обыкновенного фазана, обитающих в ссср, не имеет принципиальных отличий от разведения охотничьего фазана. Широко бытующее мнение о том, что подвиды плохо размножаются в неволе, связано с попытками проведения этих работ на диких, отловленных на воле особях. Как правило, последующие поколения птиц, выведенных и выращенных в неволе, обладают достаточно высокими для разведения на дичефермах зоотехническими показателями (яйценоскость, выводимость, сохранность молодняка и др.). Специальные работы по разведению в условиях дичеферм фазанов северокавказского, закавказского, семиреченского, хивинского, сырдарьинского, таджикского, маньчжурского подвидов показали возможность эффективного использования их как объектов искусственного дичеразведения при создании надлежащих зоотехнических условиях.

4. выбор участка для организации фермы

одной из наиболее часто допускаемых ошибок

одной из наиболее часто допускаемых ошибок при организации ферм по разведению фазанов является неправильный выбор участка для строительства. В подавляющем большинстве случаев это обусловлено стремлением работников охотничьего хозяйства максимально приблизить дичеферму к местам будущих выпусков выращенной на ней дичи. Бытует неверное представление о том, что ферма, построенная в лучших угодьях, обеспечит наилучшие результаты работы.

любая дичеферма — это производственное предприятие, успех работы которого главным образом зависит от материально-технического обеспечения всех технологических процессов. Для нормального функционирования фермы в первую очередь необходимы хорошие подъездные пути, близость линии электропередач, близость источников рабочей силы, возможность привлечения квалифицированных специалистов для экстренной помощи и консультаций. Выращенную же на ферме дичь можно перевозить для выпуска в охотугодья на значительные расстояния.

4.1. желательно, чтобы участок строительства фазанария располагался в районе, где развито птицеводство, имеются комбикормовые заводы, ветеринарное обслуживание. Близость указанных объектов обеспечит возможность быстрого привлечения специалистов для оказания, в случае возникшей необходимости, консультативной и практической помощи, облегчит получение и доставку комбикормов, Маркировать инструкции и24-18-197-89, медикаментов, Маркировать инструкции и24-18-197-89, а возможно, и получение некоторого оборудования и инвентаря.

4.2. площадка фермы по разведению фазанов должна размещаться не ближе 300 м от населенных пунктов и 1 км от птицеводческих предприятий. В то же время большая удаленность от населенных пунктов нежелательна, так как затрудняет привлечение обслуживающего персонала, обеспечение специалистов необходимыми коммунально-бытовыми услугами (ясли, детские сады, школы, больницы и поликлиники, магазины, культурно-просветительные учреждения и т. п.).

4.3. участок строительства фермы должен располагаться вблизи от шоссейной дороги, что обеспечит сокращение затрат на сооружение подъездных путей, которые должны обеспечивать круглогодичный подъезд к ферме. В то же время ферма должна располагаться не ближе 500 м от магистральных шоссейных и железных дорог.

4.4. при выборе участка для строительства фермы необходимо учесть близость источника электроэнергии и возможность подключения фермы к линии электропередач с наименьшими затратами. Желательно наличие двух источников электроснабжения (два фидера). линии электропередач должны обеспечить бесперебойное снабжение электроэнергией — трехфазным током напряжением 380/220 вольт с частотой 50 герц.

4.5. участок должен иметь небольшой уклон (не более 30 о ) желательно южной экспозиции для лучшей инсоляции, стока дождевых и талых вод.

4.6. почва на территории, где размещаются вольеры, должна быть достаточно дренированной. Тучные почвы и заболоченные участки будут способствовать возникновению различных заболеваний и затруднять обслуживание. Не исключается возможность устройства искусственного дренажа, подсыпки толстого слоя гравия и песка.

несоблюдение этих условий в ряде случаев

несоблюдение этих условий в ряде случаев приводило к осложнениям в эксплуатации дичеферм. Так, в майкопском фазанарии площадка для строительства была выбрана среди леса на тучных почвах. В результате в фазанарии распространился сингамоз, от которого гибнет молодняк, снижается продуктивность родительского поголовья, затрачиваются большие средства на профилактику заболеваний и лечение птиц.

4.7. все вольеры должны хорошо освещаться солнцем, в связи, с чем древесно-кустарниковая растительность на участке нежелательна (допустимы отдельно стоящие небольшие деревья, не создающие плотной тени). если инсоляция очень сильная (особенно это относится к южным районам), следует предусматривать искусственное затенение в виде навесов, Маркировать инструкции и24-18-197-89, шалашей, тростниковых матов, Маркировать инструкции и24-18-197-89, положенных на верх вольер. Затенения периодически перемещаются на новые места. Облучение вольер солнечными лучами уменьшает возможность возникновения заболеваний. При необходимости защиты вольер от господствующих ветров следует предусмотреть создание насаждений по периметру участка фермы, но на таком расстоянии от вольер, чтобы не затенять их.

4.8. при выборе участка для строительства фермы необходимо определить источник получения воды (гост 2874-73 «вода питьевая») и систему канализации отработанных вод (отстойники, очистные сооружения и т. п.).

4.9. выбор участка необходимо согласовать с основным землепользователем, местной санитарно-эпидемиологической и ветеринарной службой. В ряде случаев необходимо согласование с пожарной инспекцией. Для подключения к лэп проводят согласование с местной службой электроснабжения. При подключении дичефермы к имеющимся линиям водопровода, канализации, газопровода необходимо согласие соответствующих служб.

4.10. отвод участка под строительство оформляется актом отвода земельного участка, утверждается решением исполкома, после чего выдается паспорт участка установленной формы.

5. постройки и сооружения фермы

все сооружения фермы по разведению фазанов

все сооружения фермы по разведению фазанов условно можно разделить на основные и подсобные. Их размеры и количество зависят от мощности дичефермы. Если дичеферма создается в составе охотничьего хозяйства, некоторые описанные ниже подсобные сооружения можно не возводить, а использовать аналогичные, имеющиеся в охотничьем хозяйстве объекты (гараж, склад, трансформаторная подстанция, очистные сооружения и т. п.).

в настоящее время институтом цнииэпптицепром (ростов-на-дону) разработаны типовые проекты (приложение 1). эти проекты преду-сматривают варианты дичеферм разной мощности (выращивание 15, 40, 55 тыс. Голов фазанов в год), с применением разных стройматериалов, Маркировать инструкции и24-18-197-89, в разных климатических зонах ссср. При привязке типового проекта к конкретному участку для строительства фермы возможно внесение определенных изменений и дополнений, в том числе и по объему производства. Типовой проект можно получить наложенным платежом по заявке, направленной по адресу: 252057, г. киев, Маркировать инструкции и24-18-197-89, ул. Эжена потье, дом 12, киевский филиал центрального института типового проектирования госстроя ссср.

5.1. к основным (производственным) сооружениям фермы по разведению фазанов относятся: инкубаторий, птичники для содержания родительского поголовья в период размножения, вольеры для зимнего его содержания и птичники для ремонтного и товарного молодняка.

5.2. инкубаторий представляет собой капитальное одноэтажное здание, обеспечивающее поддержание внутри него заданной температуры. Минимальный набор помещений — инкубационный и выводной цеха, склад хранения инкубационных яиц, моечная, лаборатория. Желательно даже при маленьком инкубатории иметь камеру газации (дезинфекции) яиц. В инкубаториях более крупных дичеферм необходимо иметь комнату для приемки и сортировки яиц, бытовую комнату для операторов, Маркировать инструкции и24-18-197-89, раздевалку, душевую и туалетную комнаты. В здании инкубатора могут быть предусмотрены помещения с отдельными входами для размещения котельной и компрессорной. Инкубаторий должен отстоять от остальных сооружений дичефермы не менее чем на 60 м.

5.2.1. инкубационный и выводной цеха предназначены для размещения в них соответственно инкубационных и выводных шкафов инкубаторов. Высота помещений должна быть не ниже 3 м. в них устанавливают принудительную приточно-вытяжную вентиляцию и поддерживают температуру на уровне 20°с, относительную влажность воздуха 60. недопустимо прямое попадание солнечных лучей на инкубаторы, в связи с чем цеха размещают в здании так, чтобы окна из них выходили на север.

размеры помещения зависят от размеров и

размеры помещения зависят от размеров и количества инкубаторов. Инкубатор «универсал-55» имеет 3 сблокированных инкубационных камеры габаритами 5210х2530х2510 мм и одну выводную — 1830х2530×2525 мм. В цехе, где размещены инкубационные камеры, должен стоять стол для овоскопирования и письменный стол. В выводном цехе, кроме выводной камеры, устанавливают стол для выборки и сортировки выведенного молод-няка. Шкафы инкубаторов должны стоять в удалении от стен, с тем, чтобы обеспечить подход к ним со всех сторон и свободное открывание всех дверей инкубаторов.

5.2.2. склад для хранения и накопления яиц к очередной закладке в инкубатор представляет собой комнату с хорошей вентиляцией, возможностью поддержания температуры на уровне + 8. +12°с и относительной влажности воздуха 70-80. склад оборудуют этажерками для хранения и поворота яиц. Помещение склада — затененное, так как не допускается попадание на яйца прямых солнечных лучей.

5.2.3. в помещении для мойки и дезинфекции инкубационных лотков должны быть ванны для воды и дезрастворов, Маркировать инструкции и24-18-197-89, а также стеллажи для сушки инвентаря.

5.2.4. лаборатория — комната 20-25 м 2. здесь размещается стол для вскрытия отходов инкубации, письменный стол и шкафы для инструментария, химикатов и посуды.

5.2.5. камера для дезинфекции яиц должна быть оборудована системой для усиленной циркуляции воздуха и мощной вытяжной вентиляцией для удаления дезинфицирующих газов. Камера должна быть герметичной, не допускающей проникновения газов в остальные помещения инкубатория.

5.2.6. комната для приема и сортировки яиц — небольшое помещение, где размещают столы для укладки яиц, доставленных из птичника родительского поголовья, их регистрации и отбраковки.

5.2.7. бытовая комната предназначена для кратковременного отдыха и принятия пищи дежурным оператором. Раздевалку оборудуют шкафами для личной и дежурной одежды. До и после смены операторы моются под душем.

5.2.8. котельная предусматривается при инкубаториях, если нет центральной котельной.

5.2.9. компрессорная обеспечивает приток нагретого воздуха в помещения инкубатория (в первую очередь, в инкубационный и выводные залы) и удаление воздуха от инкубаторов.

5.2.10. полы во всех помещениях (кроме бытовой комнаты) могут быть цементные, покрытые керамической плиткой, из обожженного кирпича, но с обязательной защитой от почвенных вод. Несущая способность полов — не ниже 1 т на м 2. не допускаются пороги и уступы между комнатами. В инкубационных и выводных цехах, в моечном и дезинфекционном отделениях, в помещении склада яиц полы должны иметь слабый уклон для стока воды в канализацию.

5.3. птичник для выращивания молодняка представляет собой утепленное здание в форме вытянутого прямоугольника. Вдоль центральной оси здания идет коридор для прохода обслуживающего персонала шириной, обеспечивающей проезд внутрифермерского транспорта (тележки, автокары и т. п.).

5.3.1. справа и слева от коридора выгораживают секции размером 2х3 или 3х5 м. перегородки со стороны коридора и между секций выполняются из металлической сетки с ячеей не более 2,5х2,5 см, перекрытые сверху такой же сеткой или капроновой туго натянутой сеткой с ячеей не более 2х2 см. На 50-100 см от пола все перегородки делают сплошными (фанера, металл, асбоцементные плиты и т. п.) для предотвращения сквозняков и визуальной изоляции молодняка. Из коридора в каждую секцию ведет дверь (низ — сплошной, верх — сетчатый).

для удобства проведения уборки и дезинфекции

для удобства проведения уборки и дезинфекции перегородки могут быть сборно-разборные. В некоторых зарубежных фазанариях сетку перегородок (из капрона) делают подъемной к потолку, которая в опущенном состоянии крепится к сборно-разборным сплошным перегородкам.

5.3.2. с наружной стороны здания, соответственно каждой секции, устроены выгула из металлической сетки с ячеей не более 2,5х2,5 см, перекрытые сверху такой же сеткой или капроновой (ячея — та же). высота выгулов — 2 м. ширина выгулов зависит от ширины секций в помещении. Длина их может достигать 10 и более метров. В некоторых зарубежных фазанариях выгула длиной 15-20 м разделяют сетчатой перегородкой на 2-3 отсека. В этих перегородках имеются широкие двери, которые открывают (сначала во 2-й, затем в 3-й отсек) по мере роста фазанят, чем постепенно уменьшают плотность посадки птиц. При этом 2-й и 3-й отсеки обычно засевают кормовыми травами, и молодняк имеет возможность после попадания в них клевать траву и укрываться в ней. Считают, что такая конструкция выгулов обеспечивает лучшее развитие молодняка, уменьшая расклевы, и способствует дальнейшему дичанию фазанов после их выпуска в угодья.

5.3.3. из секций в помещении устраивают двери в выгулы (для выхода обслуживающего персонала) и 2 лаза с шиберными дверцами. Лазы устраивают так, чтобы они вплотную примыкали к перегородкам секций и выгулов, Маркировать инструкции и24-18-197-89, что облегчает самостоятельный вход или принудительный загон фазанят из выгула в помещение. Размер лазов: высота 30 см, ширина до 40 см. Большие по размеру лазы (когда они открыты) усиливают сквозняки внутри помещения.

5.3.4. над частью выгулов, Маркировать инструкции и24-18-197-89, примыкающей к стенке здания, делают навес, который является продолжением кровли самого здания. Особенно это необходимо в местностях, с частыми дождями, что позволяет защитить фазанят после их выпуска в выгула.

5.3.5. полы в помещении и под навесами в выгулах имеют твердое покрытие. Практика многих фазанариев показала, что в секциях (в помещении) хорошие результаты выращивания дают подогреваемые полы. Обычно подогреваемым делают не всю площадь пола в секции, а часть ее, что дает возможность птенцам найти оптимальную для них температуру.

5.3.6. в каждой секции устанавливают источник локального обогрева (брудерный зонт типа бп-1, светильники от установки икуф или «луч» из расчета один на 250 гол. Суточного молодняка).

5.3.7. в помещении предусматривают возможность поддержания температуры до +28°с. В нем должна быть устроена приточно-вытяжная принудительная вентиляция. Наилучшие результаты дает обогрев воздуха в помещении с помощью калорифера и воздуховода, установленного под потолком (методом душирования). вытяжные устройства должны обеспечивать забор воздуха из нижней части помещения.

примечание для электронной версии. Данная рекомендация вызывает серьезные сомнения, поскольку противоречит естественному распределению воздушных потоков в помещении. Использование такой системы не позволит в достаточной степени прогреть помещение или же вызовет существенное увеличение энергозатрат, повысит запыленность помещения. Наиболее целесообразно, на мой взгляд, использовать обогрев с помощью потолочных инфракрасных обогревателей. В. гагарин.

5.3.8. в современных фазанариях здания для выращивания молодняка делают безоконными, поэтому освещение в них искусственное.

5.4. описанное здание с выгулами называется акклиматизатором. В нем молодняк содержат с первого дня жизни до реализации или перевода в родительское стадо, что исключает необходимость перемещения фазанят во время выращивания. Однако описанный акклиматизатор имеет и недостатки. Его здание должно обеспечивать поддержание высокой температуры (см. П. 5.3.7), которая необходима молодняку только в первые дни жизни. После выпуска фазанят в выгула необходимость в отоплении здания отпадает. Поэтому для экономии затрат при строительстве функциональное значение акклиматизатора как бы разделяют на 2 помещения: брудерное и собственно акклиматизатор. В последнем: молодняк выращивают с 10-12-дневного возраста. В это время температура воздуха в помещении должна быть +23°с, лазы открыты, что упрощает обогрев и вентиляцию его.

5.5. брудерное помещение для выращивания молодняка с 1-го по 10-12-й день представляет собой здание акклиматизатора, но без выгулов, Маркировать инструкции и24-18-197-89, соответственно дверей в них и лазов. Поскольку пребывание молодняка в нем не превышает 1,5-2 недель, то оно может быть сравнительно небольшим. Через него проходят все партии выведенного молодняка, который в дальнейшем переводится на доращивание в акклиматизаторы. Внутреннее устройство аналогично описанному в пп. 5.3.1, 5.3.5-5.3.8.

5.5.1. описанные в пп. 5.3-5.5 Сооружения предназначены для напольного выращивания молодняка. Во многих фазанариях используют клеточное содержание молодняка с 1-го по 12-14-й день. В этом случае брудерное помещение оборудуется многоярусными клеточными батареями. Отечественная промышленность не выпускает специально для фазанов клеточных батарей, а выпускаемые для сельскохозяйственных птиц не пригодны для выращивания фазанят. Серийным производством клеточных батарей для молодняка фазанов раннего возраста занимаются некоторые зарубежные фирмы, например «виктория» (италия) и «националь» (франция). это оборудование имеется в некоторых фазанариях ссср.

после клеточного выращивания в брудерном

после клеточного выращивания в брудерном помещении молодняк переводят на напольное содержание в акклиматизаторы (см. П. 5.3).

5.6. при акклиматизаторах и брудерных помещениях предусматривают сооружение комнаты для мойки, дезинфекции и сушки инвентаря (кормушек, поилок, насестов и др.).

5.7. в типовых проектах дичеферм по разведению фазанов (см. Приложение 1), разработанных институтом цнииэпптицепром, предложено оригинальное решение блокировки инкубатория и брудерного помещения для выращивания фазанят с 1-го по 7-й день, после чего молодняк переводят на выращивание в акклиматизаторы. В проектах предусмотрено содержание молодняка в этот период в так называемых манежах — круглых ящиках диаметром 1 —1,5 м и высотой боковых стенок 40-50 см. Изготовляют их из фанеры, оргалита, пластика. Верх манежей открыт, так как фазанята до 7-дневного возраста еще не летают. Манежи приподняты над полом на 70 см (установлены на ножках). над каждым из них подвешен источник инфракрасного облучения, создающий локальный обогрев.

преимущества манежей в том, что молодняк раннего возраста оказывается приподнятым над полом в зону наиболее благоприятного температурного режима, защищенную от сквозняков. Приподнятый на 70 см от пола молодняк (на уровень стола) легче обслуживать.

возможность содержания молодняка фазанов в манежах обусловлена тем, что в раннем возрасте их можно содержать с высокой плотностью посадки — до 60 голов на 1 м 2.

5.8. в некоторых европейских фазанариях, расположенных в зонах теплого климата (югославия, венгрия), вместо акклиматизаторов, Маркировать инструкции и24-18-197-89, описанных в п. 5.3, строят отдельно стоящие утепленные домики, к которым пристраивают сетчатые выгула (обычно два на домик). один из выгулов не имеет растительности, и в него выпускают фазанят вскоре после перевода их из брудерного помещения (10-14-дневных). во второй выгул, заросший гус-той травой, фазанят выпускают в 20-30-дневном возрасте в сухую погоду, и после исчезновения росы. Внутри утепленного домика устроен обогреватель. В югославии используют газ из переносных бытовых баллонов, Маркировать инструкции и24-18-197-89, установленных с внешней стороны домика. В венгрии обогрев осуществляют за счет электрических инфракрасных излучателей (тэн). размеры выгулов от 5х20-30 м до 50х100 м. чем больше выгула, тем лучше растут фазанята, среди них меньше расклева и они быстрее дичают после выпуска в угодья.

5.9. в фазанариях с влажными почвами, приводящими к различного рода заболеваниям, иногда фазанят выращивают на сетчатых полах до реализации. Для этого в здании акклиматизатора вместо напольных секций делают клетки, приподнятые над полом на 60-70 см, вплотную примыкающие к стене здания. С наружной его стороны устроены клетки-выгула, сетчатые полы которых — на том же уровне, что и в клетках внутри акклиматизатора. Из клетки в помещении в клетку-выгул ведет лаз с шиферной задвижкой. В помещении над каждой клеткой устанавливают локальный обогреватель. В закрытой части клетки фазанят выращивают с суточного до 10-14-дневного возраста, а затем предоставляют им возможность пользоваться клетками-выгулами и выращивают до реализации. Французская фирма «националь» выпускает клетки-акклиматизаторы. Роль закрытых помещений в них выполняют утепленные домики, в которых устанавливают локальные обогреватели. В домики помещают партию суточного молодняка, которому в возрасте 10-14 дней открывают выход в клетки-выгула.

5.10. в некоторых охотничьих хозяйствах венгрии, приобретающих на дичефермах суточный молодняк, для его выращивания пользуются так называемыми «куншагами», которые устанавливают непосредственно в угодьях, куда собираются выпускать фазанов. Там, где нет возможности использовать электроэнергию, в качестве обогревателей используют горелки, в которых сжигают газ из переносных баллонов.

«куншага» представляет собой деревянный

«куншага» представляет собой деревянный ящик размером 150х75 см и высотой 50 см с покатой крышей, которая раздвигается в стороны, открывая доступ внутрь ящика, дно ящика — также деревянное. К одной из длинных сторон ящика подведены патрубки, через которые внутрь ящика идет теплый воздух от газовых горелок, установленных с наружной стороны «куншаги». В противоположной стенке внизу ящика делают горизонтальную щель вы-сотой до 15 см, закрывающуюся деревянной планкой-дверцей, прикрепленной верхней частью на петлях к стенке ящика. Эта планка-дверца открывается внутрь ящика и с помощью крючка может быть закреплена в поднятом состоянии.

в каждый ящик сажают до 50 суточных фазанят. Вначале их содержат в закрытом ящике, в котором размещены поилки и кормушки. Температуру внутри ящика регулируют подачей в него теплого воздуха от газовых горелок через патрубки. В качестве подстилки используют резаное сено, солому, а в первые дни — шершавую плотную бумагу. При достижении фазанятами 10-14- дневного возраста (в зависимости от погоды) к ящику со стороны дверцы приставляют выгул из металлической сетки на деревянном каркасе размером 150х200-300 см, сверху тоже перекрытый сеткой. Высота выгула — такая же, как и ящика — 50 см. Дверцу ящика поднимают, и фазанята имеют возможность выходить в выгул. Одновременно с этим над выгулом устанавливают дуги из толстой металлической проволоки, втыкая концы ее в землю. Расстояние между концами дуг, воткнутыми в землю, — до 3,5-4 м. дуги втыкают на расстоянии 50-70 см друг от друга, перекрывая ими пространство над приставленным к ящику сетчатым выгулом на расстоянии до 5-10 м от ящика. Поверх дуг накидывают сетку-дель, которая внизу тщательно крепится к земле с помощью проволоки или деревянных реек. Таким образом, над небольшим металлическим сетчатым выгулом образуется больший по размерам выгул из дели, натянутой на дуги. Часть этого большого выгула, примыкающая к домику, сверху дополнительно перекрывается полиэтиленовой пленкой, предохраняющей фазанят от осадков и ветров.

с ростом фазанят малый выгул разгораживают

с ростом фазанят малый выгул разгораживают (или приподнимают на кирпичи), и птенцы получают выход в большой выгул. Если погода дождливая, полиэтиленовой пленкой можно перекрыть и весь большой выгул.

при достижении фазанятами 7-недельного возраста дель, покрывающую дуги большого выгула, приподнимают от земли, и птицы выходят на волю. Некоторое время спустя они возвращаются в свои выгула, где их продолжают кормить, а затем расселяются по окружающим угодьям.

для предохранения фазанят от хищников площадку, на которой устанавливают «куншаги», огораживают забором из металлической сетки высотой до 2—3 м с углублением в почву на 30— 50 см.

5.11. родительское поголовье в непродуктивный период (вне периода размножения) содержат в так называемых зимних садах. Это — большие вольеры, имеющие форму вытянутого прямоугольника, из металлической сетки, перекрытые сверху капроновой или металлической же сеткой. Высота их — 2 м. ячея сетки стенок зимнего сада — 2,5×2,5 см, верхней — до 4,0х4,0 см. Площадь вольеры зависит от количества содержащихся в ней фазанов из расчета 5-10 м 2 на голову. Удлиненная форма вольер уменьшает беспокойство птиц при обслуживании и облегчает их отлов при формировании семейных групп к периоду размножения. Одна из узких сторон вольеры представляет собой навес шириной до 3 м, защищенный с 3-х сторон сплошными стенками из теса, горбыля, асбоцементных плит, для размещения под ним кормушек. Под навесом имеется дверь, служащая входом в вольеру. Внутри зимнего сада дополнительно устанавливают навесы, шалаши для укрытия птиц в непогоду, поилки для поения фазанов в бесснежный период.

5.11.1. вместо вольер в некоторых зарубежных фазанариях в качестве зимних садов используют загоны (не перекрытые сверху сеткой). при этом высоту стенок загона увеличивают до 3 метров, Маркировать инструкции и24-18-197-89, а содержащимся в нем птенцам подрезают маховые перья одного крыла или надевают на него путы. Использование такой конструкции зимних садов возможно только при полном отсутствии пернатых хищников.

5.11.2. рекомендуется в зимний период самцов и самок содержать в разных зимних садах. Это облегчает формирование семей к периоду размножения и повышает активность самцов. Поэтому в фазанарии должно быть минимум 2 зимних сада, если родительское поголовье эксплуатируется только 1 год, или 4, если оно содержится 2 сезона размножения.

5.12. вольеры для содержания родительского поголовья в период размножения (маточники) имеют разнообразные конструкции: переносные, стационарные, сборно-разборные. В последние годы в некоторых фазанариях за рубежом начали использовать и многоярусные клетки для содержания родительского поголовья в продуктивный период.

5.12.1. конструкции переносных вольер возникли в связи со стремлением обеспечить фазанам лучшие зоогигиенические условия. Их чаще используют в странах с влажным климатом, тяжелыми почвами, то есть благоприятными условиями для возникновения и быстрого распространения почвенных инфекций и инвазий. Периодическое перемещение фазанов на новые участки устраняет угрозу заболевания. Кроме того, после перемещения на новый участок в вольерах оказывается свежая трава, являющаяся дополнительным источником питания птиц. Переносные вольеры широко используют в настоящее время в англии, в некоторых штатах сша и канаде. Недостатками таких вольер является необходимость иметь большие площади идеально ровного поля и дополнительные трудозатраты по перемещению вольер на новые участки. Переносные вольеры устанавливают на поле, на расстоянии друг от друга, в 3-4 раза превышающем размеры самих вольер. Один раз в 7-12 дней вольеры с фазанами передвигают на рядом находящийся участок. За сезон размножения вольеры перемещаются до 6-10 раз. Прежнее место подвергается механической уборке, дезинфекции, засевается травой.

периодическая переноска вольер с места

периодическая переноска вольер с места на место (при этом обычно занято 2-4 человека) вызывает необходимость максимально облегчить их конструкции и размеры: их делают от 2х2 м при высоте 70-150 см до 3х4 м и высотой до 180 см. Стенки малых вольер иногда делают полностью из теса, только потолок затянут металлической сеткой. В вольерах больших размеров только низ боковых стенок (на 50-80 см) делают из теса, а остальные части — из тонкой металлической сетки, укрепленной на деревянном каркасе. Два (или четыре) человека слегка приподнимают вольеру, аккуратно переносят и опускают ее на новое, чистое место. Естественно, что такая операция возможна только с очень ручными фазанами, иначе они будут биться, травмироваться, и яйцекладка в последующие дни резко снизится. Чтобы фазаны не разбежались в момент, когда вольеру приподнимают, дно ее иногда затягивают крупноячеистой сеткой, однако, это создает определенные сложности при обслуживании.

5.12.2. стационарные вольеры также бывают различных конструкций (рис. 1).

рис.1. Типы стационарных маточных вольер для фазанов (размеры в м)

наиболее простые из них состоят из сетчатых выгулов, Маркировать инструкции и24-18-197-89, внутри которых устраивают небольшие навесы для укрытия птиц и, главным образом, кормов от намокания во время дождя (рис. 1А). более фундаментально устроенные вольеры имеют вид длинного сарая (не утепленного), вдоль центральной оси которого идет коридор для прохода обслуживающего персонала, а справа и слева располагаются вольеры, состоящие из темного помещения (обычно 2×2 м), навеса (тех же размеров) и сетчатого выгула (2×8-10 м). смежные вольеры имеют общие боковые стенки. Для выхода обслуживающего персонала есть двери из общего коридора в темное помещение, из последнего — под навес и из дальней стенки выгула — за пределы вольеры. Таким образом, войдя в темное помещение из коридора, можно насквозь пройти вольеру и выйти из нее с противоположной стороны. Такая конструкция вольер для содержания семей фазанов во время яйцекладки наиболее рациональна, особенно для эндемичных, еще мало прирученных подвидов. Это обусловлено тем, что при сборе яиц каждую вольеру приходится посещать не менее 2 раз в день. Появление человека в вольере всегда вызывает беспокойство птиц, особенно плохо адаптированных к условиям неволи (при размещении отечественных подвидов). обслуживающий персонал обычно входит в вольеру сначала с одной стороны, скажем, со стороны закрытого помещения, производит необходимые работы в нем, под навесом и около навеса — в близлежащей части сетчатого выгула.

птицы при этом уходят к дальней стенке

птицы при этом уходят к дальней стенке выгула и, хотя проявляют признаки беспокойства, не взлетают, не травмируются. Так обходят все вольеры сначала со стороны закрытых помещений, затем — со стороны сетчатых выгулов. При входе обслуживающего персонала со стороны сетчатых выгулов фазаны убегают под навес или в темное помещение, и у них также не бывает сильных стрессов. Если в вольерах не устраивают двери с противоположных сторон и для сбора яиц приходится обходить всю вольеру, фазаны сильно беспокоятся, что нередко приводит к торможению яйцекладки, снижению общей яичной продуктивности, травмам и даже гибели отдельных птиц.

в приморском фазанарии с успехом используют вольеры, изображенные на рисунке 1а, но в середине устраивают глухую перегородку из шифера, в которой, вплотную к сетчатым стенкам, сделаны лазы. В каждую из половин вольеры есть дверь. Перегородка играет роль ширмы, за которую фазаны прячутся, перебегая из той части вольеры, где проводят сбор яиц, уборку или раздачу корма. Когда обслуживающий персонал заходит во вторую половину вольеры через дверь с противоположной стороны ее, фазаны перебегают за перегородку, где чувствуют себя спокойно, не видя человека. Важно отметить, что в таких вольерах содержат маньчжурского фазана, еще мало адаптированного к условиям неволи. На ферме астраханского спецохотохозяйства в средней части вольеры делают не одну, а две перегородки из шифера на расстоянии до 1-1,5 м друг от друга. Каждая из перегородок не доходит до стенки вольеры, оставляя свободный проход для обслуживающего персонала у первой перегородки — справа, у второй — слева (рис. 2). Промежуток между перегородками перекрыт сверху шифером, что создает возможность фазанам укрыться от дождя и града.

рис. 2. Вольеры для содержания родительского

рис. 2. Вольеры для содержания родительского поголовья северокавказских фазанов в продуктивный период на дичеферме астраханского спецохотхозяйства

5.12.3. сборно-разборные вольеры все чаще стали применять в практике содержания фазанов. Их собирают из стандартных деталей. Обычно это — рамы размером от 2х4 м до 2х3 м из металлического уголка или труб, на которые натянута металлическая сетка. Имеются рамы, в которых сделана дверь. Собирают вольеры на заранее подготовленной и продезинфицированной площадке в начале февраля, устанавливают вплотную друг к другу для экономии площади и сборных конструкций. Нередко их размещают так, что попасть внутрь одной вольеры можно только через соседние. Собранные вольеры сверху перекрывают капроновой сеткой.

по окончании сезона размножения птиц перемещают в «зимние сады», а рамы разбирают, дезинфицируют и складывают до следующей весны. Освободившуюся площадку очищают, также дезинфицируют, перепахивают и засевают травой. На следующий год вольеры собирают на другой, рядом находящейся площадке. Таким образом, каждая из них эксплуатируется через год, что обеспечивает лучшие санитарные и зоогигиенические условия.

недостатком сборно-разборных вольер является необходимость ежегодных дополнительных трудозатрат по оборудованию площадок, а также конструктивные особенности самих вольер.

так, чтобы накормить птиц, собрать яйца, произвести текущую уборку, приходится проходить через одну вольеру в другую, а при ее небольших размерах (3х3 или 4х4 м) это очень тревожит птиц. В таких вольерах можно содержать только очень ручных фазанов. При разведении же отечественных подвидов сборно-разборные вольеры применять нельзя.

5.12.4. во многих зарубежных фазанариях для размещения родительского поголовья в период размножения используют многоярусные клетки. Каждая клетка имеет размер 1,5х3-5 м при высоте до 70 см. Пол в клетках — из металлической сетки, наклонный (около 6-7°), заканчивающийся вне клетки желобом яйцесборником, в который отложенные фазанками яйца выкатываются из клетки. Кормушки (обычно бункерные) укреплены на дверце клетки, поилки — автоматические. Между ярусами клеток нет поддонов для помета, который проваливается через ниже расположенные клетки на площадку с твердым покрытием, на которой установлены клетки, и смывается водой. Клетки размещают на открытых площадках или в помещении с искусственным микроклиматом и световым днем для получения ранней яйцекладки. Подобных клеток отечественная промышленность не выпускает, и переоборудовать их из клеток, выпускаемых для сельскохозяйственной птицы, не представляется возможным.

преимущества клеток — в компактности размещения

преимущества клеток — в компактности размещения родительского поголовья, лучших зоогигиенических условиях, облегчении ухода и сбора яиц. В то же время исследования цнил показали, что фазаны в них откладывают меньшее количество яиц и их инкубационные качества (в первую очередь, оплодотворенность) — ниже, чем у фазанов, Маркировать инструкции и24-18-197-89, содержащихся в вольерах (напольное содержание). кроме того, менее адаптированные к разведению в неволе подвиды фазанов при содержании в клетках сильно травмируются и находятся в состоянии постоянного стресса.

применение клеток для родительского поголовья фазанов на отечественных дичефермах пока нельзя считать целесообразным.

5.13. на площадке, где размещаются вольеры (или клетки) для содержания родительского поголовья в период размножения, необходимо предусмотреть навес (или помещение) для мойки и дезинфекции кормушек и поилок, которые недопустимо перевозить для этой цели в зону выращивания молодняка или в инкубаторий.

5.14. к подсобным помещениям относятся: склад для хранения кормов, Маркировать инструкции и24-18-197-89, кормокухня, склад подстилки (или навес), ветпункт, дезопункт, навозохранилище и вспомогательные сооружения (лэп, трансформаторная, дизельная, ремонтные мастерские, дороги, водопровод, канализация, отстойники, гараж, забор и т. п.).

5.15. склад для хранения кормов представляет собой неотапливаемое помещение, оборудованное бункерными ларями для хранения различных сыпучих кормов. Поскольку завоз кормов в хозяйство должен быть не реже ежеквартального (4 раза в год), то емкость зерносклада определяется 1/4 годовой потребности кормов.

для хранения скоропортящихся продуктов

для хранения скоропортящихся продуктов, Маркировать инструкции и24-18-197-89, если возможность скармливания их имеется в хозяйстве (творог, обрат и т. д.), необходимо предусмотреть устройство холодильной камеры в помещении зерносклада или рядом с ним. Холодильная камера может быть оснащена фреоновым автоматизированным холодильным агрегатом типа цф-50 или цф-56. емкость камеры должна быть не менее 20-25 м3.

5.16. кормокухня должна иметь производственную емкость, рассчитанную по периоду наибольшего выращивания молодняка. В кормокухне размещают корыта или механизмы для смешивания кормов, Маркировать инструкции и24-18-197-89, столы и механизмы для измельчения овощей и резки травы, весы. Кормокухня имеет водопровод и канализацию. Допускается блокировка помещений кормокухни и склада для хранения комбикормов в одном здании.

5.17. помещение для хранения подстилки должно быть сухим, хорошо проветриваемым. Возможно устройство навеса вместо помещения, однако при этом должны быть приняты меры, не допускающие намокания подстилки при дожде и снегопаде.

5.18. ветпункт должен иметь помещения для хранения и приготовления к употреблению дезсредств, Маркировать инструкции и24-18-197-89, медикаментов, Маркировать инструкции и24-18-197-89, а также комнату для проведения патологоанатомических исследований. Здания и сооружения ветеринарной и санитарной службы строят в зависимости от размера и назначения предприятия в соответствии с «нормами технологического проектирования ветеринарных объектов» (нтп-сх-8-67) и «ветеринарно-санитарными требованиями при проектировании и эксплуатации специализированных птицеводческих хозяйств и ферм» (1975).

для крупных фазановодческих хозяйств предусматривают

для крупных фазановодческих хозяйств предусматривают ветеринарные и санитарные объекты: ветеринарную лабораторию со складом дезсредств, Маркировать инструкции и24-18-197-89, санитарный блок (проходная, гардеробная с сушильным шкафом, умывальная, душевая, помещения для дезинфекции одежды), дезинфекционный блок, пункт дезинфекции яичной тары, убойно-санитарный пункт, дезбарьеры, карантин для вновь поступившей птицы.

ветпункт должен быть расположен в удалении от остальных сооружений дичефермы. При нем могут быть предусмотрены вольеры для содержания больных птиц (травмированных, слабых, но не инфекционно больных).

5.19. в удалении от территории дичефермы (не ближе 100 м) устаивают пометохранилище. Это — емкость, имеющая непроницаемые дно и стенки, плотно закрывающуюся крышку, в которой происходит термическое обезвреживание навоза.

5.20. вблизи от пометохранилища устраивают печь для сжигания трупов и отходов инкубации.

5.21. забором отгораживают всю площадку дичефермы, а также перегораживают ее территорию на две или три зоны: производственную, где размещают птичники и инкубаторий, и подсобную. Иногда выгораживают изолятор с ветпунктом.

рекомендуется производственную зону разделить на два участка: для содержания родительского поголовья и для выращивания молодняка. Инкубаторий может размещаться между ними. Кормосклад и кормоцех желательно размещать на границе производственной и подсобной зон с таким расчетом, чтобы завозимые корма могли загружаться в них из подсобной зоны, а выгружаться для развозки птицам на территорию производственной.

6. оборудование, инвентарь, измерительные приборы

отечественная промышленность не выпускает

отечественная промышленность не выпускает пока оборудования, специально разработанного и предназначенного для фазановодства. Вместе с тем некоторое оборудование и инвентарь, производящийся для птицеводства и звероводства, а также для пищевой промышленности и приусадебных хозяйств, Маркировать инструкции и24-18-197-89, вполне могут быть использованы на дичефермах.

6.1. отечественная промышленность выпускает для промышленного птицеводства инкубаторы большой емкости: универсал-55 и икп-90. оба эти инкубатора возможно использовать в крупных фазанариях с выращиванием фазанов в количестве более 50 тыс. Голов молодняка в год, при переоборудовании лотков под фазаньи яйца.

инкубатор универсал-55 состоит из 3 инкубационных шкафов общей емкостью 48 тыс. Куриных яиц (по 16 тыс. Каждый шкаф) и одного выводного емкостью 8 тыс. Куриных яиц. Инкуба-тор икп-90 состоит из 6 инкубационных камер, каждая из которых вмещает по 13,1 тыс. Куриных яиц и одного выводного той же емкости.

в настоящее время отечественная промышленность выпускает малогабаритные инкубаторы для приусадебного птицеводства: «наседка» и ипх-5-01. первый вмещает 85 фазаньих яиц, второй — 100. оба инкубатора имеют автоматическую систему поворота яиц и поддержания постоянной температуры на уровне 37,5°с. Начат серийный выпуск лабораторного инкубатора илу-ф-0,3, который вмещает до 400 фазаньих яиц. Этот инкуба-тор имеет регулируемый автоматический поворот лотков, Маркировать инструкции и24-18-197-89, температурный режим в пределах от 0 до 50°с, воздухообмен. Влажность во всех 3-х описанных агрегатах регулируется за счет поверхности испарения воды с лотка, установленного внутри камеры инкубатора.

из зарубежных малогабаритных инкубаторов в отечественных фазанариях хорошо зарекомендовали себя инкубаторы фирмы «виктория» (италия), «националь» (франция), «биос» (чехословакия) и другие.

6.2. для проведения овоскопирования (просвечивания яиц во время инкубации при проведении биологического контроля за развитием эмбрионов) в фазанариях рекомендуется использовать овоскоп отечественного производства и11-а, а также обыкновенные фильмоскопы любой марки.

6.3. для взвешивания яиц и суточного молодняка удобнее всего использовать весы влкт-500. для молодняка старшего возраст и взрослых птиц удобно использовать обычные торговые циферблатные весы (типа внц-2 или внц-10), а также медицинские весы для взвешивания младенцев.

для взвешивания целиком инкубационного

для взвешивания целиком инкубационного лотка с уложенными в него яйцами (при проведении биологического контроля за ходом инкубации) можно использовать весы внц-10 или адв-200м.

в крупных инкубаториях необходима установка для мойки инкубационных лотков умл-1, дезокамеру оборудуют установкой одк. Для хранения и перевозки яиц внутри инкубатора используют этажерки-тележки у-55.

6.4. для измерения температуры и влажности в помещениях инкубатория пользуются бытовыми психрометрами пбу-1, а для постоянной автоматической регистрации этих параметров воздуха можно использовать термографы м-16с (суточный) или м-16н (недельный) и гигрографы м-21с (суточный) или мв-21м (недельный). для измерения освещенности следует пользоваться люксметром ю-16.

6.5. для снижения температуры воздуха в помещениях инкубационного и выводного залов (особенно это бывает необходимо в южных районах страны) используют бытовой кондиционер типа «азербайджан».

склад для хранения инкубационных яиц также необходимо оборудовать установками охлаждения воздуха типа «азербайджан» или специальными фреоновыми установками.

для хранения витаминов удобно использовать обычные бытовые холодильники, обеспечивающие поддержание температуры + 4°с.

6.6. для локального обогрева молодняка используют инфракрасные излучатели типа бп-1, икуф, «луч» и некоторые другие.

6.6.1. брудерный зонт бп-1 (или бп-1а) обеспечивает автоматическое поддержание заданной температуры. Однако его подвеска над полом, особенно в первые дни жизни молодняка, очень низкая, и трудно проследить за состоянием фазанят под зонтом.

6.6.2. установки икуф-1, икуф-1м и «луч» состоят из 20, 40, 60 или 80 облучателей и блока программного управления. Каждый облучатель содержит две инфракрасные лампы икзк-220-250 и одну эритемную лэ-15 или эритемно-осветительную лэо-15. инфракрасные лампы питаются от сети 220 вольт, эритемные — от напряжения 127 вольт, что вызывает необходимость подключения светильников через блок программного управления. Монтаж установок в акклиматизаторах имеет определенные не-достатки: программа обогрева одинакова для всех светильников в то время как в акклиматизаторах, как правило, содержится разновозрастный молодняк фазанов, Маркировать инструкции и24-18-197-89, нуждающийся в разных режимах облучения. Светильники установки икуф-1 имеют индивидуальные выключатели каждой лампы, поэтому их можно подвешивать с самостоятельным включением (минуя пульт программного управления) в сеть. Однако в этом случае необходимы дополнительные устройства на каждом светильнике, обеспечивающие 127 вольт для эритемной лампы и заземление каждого из них.

в целом светильники икуф удобнее в эксплуатации

в целом светильники икуф удобнее в эксплуатации в фазанариях, чем «луч».

6.6.3. вместо источников инфракрасного облучения — ламп икз-220-250 можно использовать излучатели типа эис-0.25и (они не излучают видимых лучей), что позволяет применять ограниченный световой режим при выращивании фазанят, предотвращающий расклев среди них.

примечание к электронной версии: термин «расклев» применяется в случае расклева яиц маточным стадом. При выщипывании фазанами перьев друг друга правильнее использовать термины «птерофагия» или «каннибализм». В. гагарин

6.6.4. вместо установок икуф, «луч» можно использовать облучатели и для одной инфракрасной лампы икзк-220-250: сспо1-250, ори-1, оэи-500, ов1-1; а также для «темных» источников тепла (тэн)—окб-3296 и окб-1376а или облучатель эи-1.0-и1 (с керамическими источниками инфракрасного излучения). на основе инфракрасных ламп, выполненных в виде цилиндрических трубок типа ки, кг и кгт, в латвии разработан и серийно выпускается подвесной облучатель «латвико».

6.7. для регистрации параметров микроклимата в помещениях для содержания молодняка рекомендуется использовать те же приборы, что и в инкубатории (см. 6.4).

6.8. в качестве кормушек для молодняка раннего возраста (1-3 дня) используют противень л-1, для молодняка старшего возраста удобна в эксплуатации желобковая кормушка к-1а (до 25-дневного возраста) и к-4а (старше 25-дневного), для взрослых фазанов, Маркировать инструкции и24-18-197-89, особенно в «зимних садах», с успехом используется автокормушка лск (бункерная) или бункер-самокормушка типа бсу-0,5, сбг-0,3, кбс-1. для минеральных кормов и гравия рекомендуется кормушка кмп. Бункерные кормушки для сухих сыпучих кормов можно изготовить в самом хозяйстве.

6.9. для поения молодняка раннего возраста лучше всего использовать вакуумные поилки, применяемые в птицеводстве, пв. Месячных фазанят можно поить с использованием автоматических поилок ап-2 или поилок ап-3 гост 19087-73.

при клеточном выращивании можно использовать

при клеточном выращивании можно использовать автоматические поилки для кроликов пп-1, разработанные опкб ниипзк. При напольном выращивании больших групп молодняка эти поилки также можно использовать, но количество их должно быть достаточно большим, чтобы обеспечить необходимый фронт поения (приложение 2).

взрослых птиц следует поить из поилок п-4а (подвесных чашечных с автоматической подачей воды из водопровода). при отсутствии автоматических поилок можно использовать желобковые поилки. В период содержания фазанов в маточных вольерах можно использовать даже полулитровые стеклянные банки. Однако отсутствие автоматических поилок значительно осложняет уход и увеличивает затраты ручного труда.

6.10. насесты для взрослых птиц и молодняка делают в самих хозяйствах. Поперечные жерди крепят к вертикальным стойкам с помощью одного гвоздя. Это дает возможность складывать их при необходимости переноса из вольер для очистки и дезинфекции.

6.11. при необходимости удлинения светового дня (для ранней яйцекладки) целесообразно использовать автоматическое устройство «прус-1» или «прус-2». незначительная замена рабочего барабана обеспечит любой режим включения и выключения дополнительного освещения.

6.12. кормосклад желательно оборудовать бункерными емкостями. Исходя из объема единовременного хранения кормов и их набора можно использовать бункеры типа б-6 или бск-10.

6.13. кормоцех (кормокухня) для доработки кормов и приготовления к скармливанию оборудуется рядом агрегатов. С учетом необходимой производительности (расхода кормов) эти агрегаты должны быть небольшими. Поэтому приходится использовать оборудование, не применяемое на крупных птицеводческих предприятиях или комбикормовых заводах, а используемое в звероводстве, пищевой промышленности и специально выпускаемое в настоящее время для приусадебного животноводства. Наиболее приемлемыми для этих целей можно считать следующие машины: измельчитель кормов, Маркировать инструкции и24-18-197-89, малогабаритный икм-0,8 (для измельчения зерна и шинкования корнеплодов), кормо-корнерезки экр-1-ту-27-40, лабораторный смеситель лс-1, весы почтовые (платформенные, грузоподъемностью 50-100 кг).

6.14. в настоящее время в стране нет типовых или индивидуальных проектов малогабаритных цехов по приготовлению и доработке кормов, Маркировать инструкции и24-18-197-89, пригодных для фазанариев. Такие проекты разрабатываются институтом укрниигипросельхоз (г. киев) совместно с цнил главохоты рсфср. В связи с этим при выборе агрегатов по переработке кормов (см. П. 6.13), их комплектовании в единую технологическую линию следует проконсультироваться у специалистов ближайшего комбикормового завода или птицефабрики.

6.15. для облегчения и сокращения ручного труда при перевозке и раздаче кормов, Маркировать инструкции и24-18-197-89, уборке помещений для содержания птиц необходимо иметь внутрифермерские транспортные средства: тележки (ту-300), автокары, мотороллеры типа «муравей» и др.

6.16. для текущей дезинфекции в фазанарии следует иметь собственные переносные опрыскиватели: гидропульт ручной, гидропульт скальчатый гс-2.

в ряде случаев некоторые из них можно использовать

в ряде случаев некоторые из них можно использовать для побелки стен и потолков.

при крупных плановых и экстренных работах по дезинфекции целесообразно обращаться на местные ветеринарные станции, которые имеют более совершенное специализированное оборудование для санитарно-ветеринарной обработки помещений и выгулов и дичеферме нет необходимости иметь его у себя.

6.17. при оборудовании веткомнат, лаборатории при инкубаторах целесообразно использовать выпускаемые отечественной промышленностью медицинские одностворчатые или двухстворчатые шкафы и шкафы для хранения инструментария. Необходимо иметь стол операционный для мелких животных а-2 или стол ветеринарный для мелких животных свг-2 (авт. Горкин н. а.), ящики для перевозки трупов птиц (авт. Трифилов). из мелкого ветеринарного инвентаря рекомендуется иметь: кюветы стальные эмалированные размером 130×180; 180х120; 240×300; 400×400 мм, тазики и почкообразные стальные эмалированные 160х73—33; пинцеты с прямыми и изогнутыми браншами (большие и малые — глазные), ножницы прямые и изогнутые, скальпели остроконечные и брюшистые, ножи ветеринарные брюшистые и ампутационные малые, столик передвижной мани-пуляционный, столик инструментальный, малые хирургические и анатомические наборы, перчатки резиновые анатомические и хирургические, спринцовки резиновые. Здесь перечислен только минимум оборудования и инвентаря.

6.18. мойки необходимо оборудовать емкостями для замачивания кормушек и поилок, мытья и дезинфекции их. В качестве таких емкостей можно использовать разборную металлическую (авт. Сальников) или бытовые ванны, для мытья мелкого инвентаря мойки оборудуют большими раковинами (лучше двухсекционными). для получения горячей воды целесообразно использовать электротитаны типа эв-150м; унс-100; вэп-600.

7. выбор системы содержания фазанов

при выборе той или иной конструкции сооружений

при выборе той или иной конструкции сооружений фазанария и их оборудования исходят из наиболее целесообразной для конкретного хозяйства системы содержания родительского поголовья и молодняка, которая зависит от объема производства, формы разводимого фазана, климатических, почвенных условий, материальных и трудовых ресурсов хозяйства и т. д.

7.1. в большинстве фазанариев страны применяют напольное содержание птиц, так как отечественная промышленность не производит клеточных батарей для содержания взрослого поголовья и молодняка. В фазанариях, имеющих импортное оборудование, целесообразнее выращивать молодняк с 1-го по 10-12-й день в многоярусных клетках для фазанят (см. П.5.5.1). если в хозяйстве есть возможность изготовить манежи, можно молодняк с 1-го по 7-й день выращивать в них (см. П. 5.7.).

7.2. если хозяйство легко может быть обеспечено подстилкой (волокнистый торф, крупная стружка, резаное сено или солома, дробленая сердцевина кукурузных початков, Маркировать инструкции и24-18-197-89, сухой крупный песок или мелкая ракушка и т. д.) или расположено в зоне теплого климата, можно отказаться от подогреваемых полов в брудерном помещении и акклиматизаторах.

7.3. родительское поголовье целесообразно содержать в непродуктивный период в общих вольерах (зимних садах) и переводить на содержание по семьям лишь в продуктивный период. Это облегчает уход за птицами в непродуктивный период, повышает активность самцов (при раздельном содержании половых групп), позволяет «отдохнуть» сооружениям для содержания взрослых птиц. Во время нахождения птиц в зимних садах ма-точники пустуют, в них можно провести тщательную уборку, дезинфекцию, мелкий и даже капитальный ремонт. То же можно произвести в зимних садах, пока родительское поголовье находится в маточниках. В это время в зимних садах можно произвести посадку и посев кормовых растений. Такой разрыв во времени пребывания птиц на одной и той же территории (санитарный разрыв) обеспечивает лучшие санитарно-гигиенические условия, уменьшает возможности возникновения заболеваний (особенно тех, которые связаны с почвой).

7.4. сроки выращивания товарного молодняка на дичеферме имеют решающее влияние на экономические показатели работы фазанария. От них зависит и количество акклиматизаторов, Маркировать инструкции и24-18-197-89, а следовательно, капитальных вложений в строительство фазанария.

при высоком уровне организации фазановодства

при высоком уровне организации фазановодства в охотничьем хозяйстве дичеферма может реализовать ему часть молодняка в суточном возрасте. Для этого в охотничьем хозяйстве должны быть построены акклиматизаторы (или «куншаги» — см. П. 5.10), должен быть квалифицированный штат обслуживающего персонала, соответствующее оборудование и корма. В перспективе с развитием дичеразведения в охотничьих хозяйствах, созданием в них надлежащей материально-технической базы такой вариант выращивания фазанов наиболее рационален. При этом фазанарий может увеличивать родительское стадо и сооружения для его содержания (зимние сады и маточники) без дополнительного расширения объема выращивания молодняка, так как часть его будет реализовываться в суточном возрасте.

если в охотохозяйствах, расположенных в северных широтах, построены стационарные адаптационные вольеры с отделениями для искусственного обогрева, в них можно завозить фазанят в возрасте 45-49 дней и доращивать их до 10-12-недельного возраста, после чего выпускать в угодья. В этом случае возраст реализуемого с дичефермы молодняка может не превышать 49 дней.

8. расчет объемных показателей дичефермы

8.1. для расчета площадей основных сооружений, количества секций для взрослого поголовья и молодняка, количества яйцемест в инкубаторах можно использовать таблицу основных зоотехнических показателей (приложение 1), а также составить циклограмму основных производственных процессов с учетом плановых объемных показателей.

8.2. расчет необходимо начинать с установления численности родительского поголовья, которое может обеспечить получение заданного количества молодняка. Используя таблицу (см. Приложение 1), ведут расчет в следующем порядке:

определяют, сколько должно быть суточного

определяют, сколько должно быть суточного молодняка, чтобы вырастить необходимое количество товарного (49-60-дневного) молодняка, при его сохранности с 11-го дня 80, 11-дневных должно быть на 20 больше: количество 60-дневных — 80, а 100 — х;

полученное количество 11-дневного молодняка составляет 90 от суточного, количество которого можно вычислить аналогичным путем: 11-дневных — 90, а суточных — х;

определяют количество яиц, необходимое для получения найденного количества суточного молодняка при условии, что выводимость составляет 75 (см. Приложение 2); этот процент соответствует найденному количеству суточного молодняка, а 100 будет соответствовать яйцам, пригодным для инкубации;

яйца, пригодные для инкубации, составляют только 85 от всего количества, отложенного самками, что позволяет вычислить общее количество яиц, которое необходимо получить от самок;

найденное количество отложенных яиц делят на среднее количество яиц, получаемой от каждой самки, и вычисляют, сколько самок требуется в родительском стаде;

исходя из принятого полового соотношения в хозяйстве (от 1:5 до 1:7), делят количество самок соответственно на 5 или на 7 и получают количество самцов;

сложив количество самок и самцов, Маркировать инструкции и24-18-197-89, получают общее поголовье родительского стада в первом приближении.

8.3. для частичной или полной замены родительского стада необходим ремонтный молодняк, количество которого определяют по проценту обновления стада: при 100-ной замене — ремонтного молодняка оставляют с учетом его сохранности до начала размножения, при 50-ной замене — около 60 с той же поправкой. Таким образом, с учетом естественного отхода стада, а также 10-15-ной отбраковки молодняка при переводе его в родительское стадо производят расчет родительского стада, необходимого для производства ремонтного молодняка, аналогично п.8.2.

8.4. суммируя родительское поголовье, требуемое для получения заданного количества ремонтного и товарного молодняка, получают его численность во втором приближении.

8.5. исходя из вычисленного поголовья и плотности его посадки, производят расчет площадей зимних садов и их количества, а также количества секций в маточниках (с учетом принятого соотношения полов в семьях).

8.6. зная количество молодняка (ремонтного плюс товарного) по группам технологического выращивания, определяют потребное количество секций в акклиматизаторах. При составлении циклограммы птичники, занятые выращиванием ремонтного молодняка, не удается использовать повторно в одном сезоне. Птичники, занятые товарным молодняком, могут освобождаться по мере достижения им возраста реализации (от 7 до 12 недель). часть из них может быть использована повторно после соответствующего санитарного разрыва, за время которого проводят их уборку и дезинфекцию. При построении циклограммы количество таких птичников легко выявить и предусмотреть меньшее их количество при строительстве дичефермы.

8.7. объем брудерных помещений рассчитывают с учетом принятой системы содержания в них молодняка (напольное, клеточное, в манежах) и принятых сроков содержания (до 7, 10 или 12 дней), а также периодичности закладки партий яиц в инкубаторы и, следовательно, выводов очередной партии молодняка. Рекомендуется производить закладки новой партии яиц в инкубаторы один раз в 7 дней. Количество мест для размещения суточного молодняка в брудерном помещении должно в 2 раза превышать численность молодняка, которое можно получить в пик яйцекладки, рассчитав его по таблице 1.

таблица

таблица 1

естественное распределение количества яиц, отложенных фазанами в вольерах (процент от общего числа за сезон) по пятидневкам

.

Инструкция по эксплуатации анвв-50

Уважаемые посетители нашего сайта, эта страница посвящена — Инструкция по эксплуатации анвв-50.

 


 

Инструкция по эксплуатации анвв-50Букмекерская контора "ЛЕОН" - ставки на спорт

 

техническая документация

техническая документация

руководства эксплуатации трк; ливенка;

колонки топливораздаточные 1кэд >ливенка-11100>, 2кэд >ливенка-11200>, 2кэд >ливенка-12200> с блоком гидравлическим 323.20.00.00.00

уководство по эксплуатации 026.00.00.00-01 рэ

колонки топливораздаточные 1кэд >ливенка-11110>, 2кэд >ливенка-22220> с блоком гидравлическим 323.20.00.00.00

руководство по эксплуатации 026.00.00.00-03 рэ

колонки топливораздаточные 2кэд >ливенка-22200>, 2кэд >ливенка-22400>, 2кэд >ливенка-23400>, 2кэд >ливенка-24400> с блоком гидравлическим 323.20.00.00.00

руководство по эксплуатации 026.00.00.00-02 рэ

колонки топливораздаточные 1кэд >ливенка-11101>, 2кэд >ливенка-11201>, 2кэд >ливенка-22201>

руководство по эксплуатации 170.00.00.00-01 рэ

колонки топливораздаточные 2кэд >ливенка-34801>, 2кэд >ливенка-33601>, 2кэд >ливенка-32401>, 2кэд >ливенка-31201> с агрегатом гидравлическим 379.00.00.00.00

руководство по эксплуатации 323.00.00.00.00-05 рэ

колонки топливораздаточные 2кэд >ливенка-34800>, 2кэд >ливенка-33600>, 2кэд >ливенка-32400>, 2кэд >ливенка-31200> с блоком гидравлическим 323.20.00.00.00

руководство по эксплуатации 026.00.00.00-06 рэ

колонки топливораздаточные 1кэд >ливенка-41101> для отпуска масел

руководство по эксплуатации 421.00.00.00 рэ

колонки топливораздаточные 1кэд >ливенка-41101> для отпуска светлых нефтепродуктов

руководство по эксплуатации 421.00.00.00-01 рэ

схемы электрического шкафа для подключения

схемы электрического шкафа для подключения трк

насос анвв-50

назначение

агрегаты напорно-всасывающие выносные анвв-50, анвв-100 предназначены для подачи топлива (бензин, керосин и дизельное топливо) вязкостью от 0,55 до 40 мм/с (от 0,55 до 40 сст) к топливораздаточным колонкам с напорной гидравликой.

агрегат монтируется в непосредственной близости от топливного резервуара, что позволяет уменьшить высоту самовсасывания и расположить топливораздаточную колонку на расстоянии от топливного резервуара до 100м.

для удобства монтажа на азс, агрегат выполнен на монтажном поддоне не требующем фундамента и одновременно обеспечивающим сбор и отвод проливов топлива. В составе агрегата используется прямоприводный шестеренчатый насос с торцевым уплотнением вала. Предусмотрены фильтр грубой очистки с тонкостью фильтрации 10мкм и фильтр тонкой очистки 20мкм, а также газоотделитель

технические характеристики

инструкция по эксплуатации пежо 308 — страница 175

добавить комментарий

имя (обязательное)

e-mail (обязательное)

подписаться на уведомления о новых комментариях

новости пежо

20.12.2012

компания peugeot сообщает о том, что 8 декабря завершился масштабный тест-драйв модели peugeot 408 road show. Каждую субботу с 3 ноября по 8 декабря в одиннадцати крупнейших городах страны проходило «большое шоу для большой страны», в рамках которого peugeot 408 объехал всю россию.

14.12.2012

компания peugeot представляет уникальную

компания peugeot представляет уникальную кредитную программу peugeot finance, по которой покупатели нового peugeot 408 могут получить кредит по рекордно низкой ставке – 4,08.

12.12.2012

компания peugeot россия сообщает, что 12 декабря 2012 года запущена новая версия корпоративного сайта www. Peugeot. Ru, который стал еще более технологичным, информативным и понятным для пользователей. Интуитивный интерфейс выгодно отличает www. Peugeot. Ru от сайтов других автомобильных брендов и значительно облегчает процесс подбора автомобиля и поиска ближайшего дилера.

06.12.2012

peugeot 208 осуществил революцию в эргономике внутреннего пространства автомобиля, предлагая совершенно новые ощущения от вождения. Одним из важных элементов эргономики является мультимедийный комплекс с 7-дюймовым сенсорным дисплеем, расположенным в пределах легкой досягаемости водителя на уровне глаз, для обеспечения максимальной безопасности, комфорта и гармонии с другими компонентами панели управления.

05.12.2012

в рамках последнего этапа чемпионата франции по ралли, который прошел с 23 по 25 ноября в департаменте вар, автомобили peugeot трижды победили в заездах разных категорий.

.